Cell Culture

Human PDLCs were isolated from extracted premolars of ten young patients (aged 12–26 years) requiring orthodontic treatment. The demographic information and clinical parameters of different donors have been described in detail in Supplementary Table 1. Written informed consent was obtained from each participant in our experiment. This study was approved by the ethics committee of Peking University Shenzhen Hospital (Approval Number: 2024–032-01) and was conducted in accordance with the Helsinki Declaration of 1975, as revised in 2013. PDLCs were isolated as described previously [15]. Cells between passages 3–6 were used in the following experiments.

LPS Treatment

Escherichia coli LPS was purchased from Sigma. After 12 h of serum starvation, PDLCs were cultured in α-MEM containing 10% FBS with or without different concentrations of LPS (0 µg/mL, 0.1 µg/mL, 1 µg/mL). At different points of time (0, 12, 24, 48 h) of LPS stimulation, cells were harvested for RNA extraction.

miRNA/siRNA Transfection

miR-221-3p and miR-222-3p mimics, inhibitors, siRNA oligos targeting PAK1 (siPAK1-1293, siPAK1-853, and siPAK1-544) and their negative controls (NC/inhibitor NC/si-NC) were designed and composed by Genepharma (Shanghai, China). Their sequences are listed in Table 1. These oligos were transfected into PDLCs with HiPerFect (Qiagen, Germany) reagent according to the manufacturer’s protocol. After 48 h, transfected cells were harvested for RNA and protein analyses.

Table 1 RT-qPCR primers and miRNA/siRNA sequences used in this manuscriptCCK8 Assay

The effect of miR-221/222-3p overexpression or knockdown on cell viability was determined using the CCK8 kit (Dojindo, Japan) as the manufacturer’s instructions. Six replicate samples were prepared and measured in each group.

Reverse Transcription-Quantitative PCR (RT-qPCR)

Total RNA was extracted from human PDL and rat periodontium using RNAiso Plus reagent (Takara Bio, Inc. Japan) according to the manufacturer’s instructions. A total of one μg RNA was reverse transcribed into cDNA using the PrimeScript™ RT Master Mix (Takara Bio, Inc. Japan) or Mir-X miRNA First-Strand Synthesis kit (Takara Bio, Inc. Japan). cDNA was used as the template for the subsequent qPCR analysis. qPCR analyses were carried out to detect the expression levels of relative target genes using SYBR Premix EX Taq solution (Takara Bio, Inc. Japan) according to the manufacturer’s protocol. The forward primers of miRNAs for qPCR are their full sequences. And the reverse primers of miRNAs for qPCR are provided in Mir-X miRNA First-Strand Synthesis kit purchased from Takara Bio, Inc. The full length sequences for hsa-miR-221-3p, hsa-miR-222-3p, rno-miR-221-3p, rno-miR-222-3p are listed as follows:

hsa-miR-221-3p:AGCUACAUUGUCUGCUGGGUUUC

hsa-miR-222-3p:AGCUACAUCUGGCUACUGGGU

rno-miR-221-3p:AGCUACAUUGUCUGCUGGGUUUC

rno-miR-222-3p:AGCUACAUCUGGCUACUGGGU; Specific primer sequences for mRNA are listed in Table 1. U6 and GAPDH were used as internal controls for miRNA and mRNA normalization, respectively. The thermocycle conditions used in amplification were as follows: 95 ℃ for 5 s; 60 ℃ for 30 s; 72 ℃ for 30 s. The set amplification cycle is 40. Relative expression was analyzed by using the 2−ΔΔCq method reported by Livak and Schmittgen [16]. All RT-qPCR assays were performed in triplicate and were repeated at least three times.

ELISA

The expression levels of inflammatory factors (IL-6 and IL-8) in the supernatants of treated and untreated PDLCs were measured using the corresponding human ELISA kit (Neobioscience, Shanghai, China) according to the manufacturer’s instructions.

Western-Blot Analysis

PDLCs were harvested and lysed with RIPA buffer containing protease and phoshatase inhibitors (Roche, Germany). The protein concentration was measured using a BCA protein assay kit (Thermo Scientific, Waltham, MA, USA). An equal amount of protein from each sample was loaded into precast gel (MCE, USA) for electrophoresis and then transferred onto PVDF membrane (Millipore, Billerica, MA, USA). The PVDF membrane was blocked with BSA for 1 h and incubated with primary antibodies overnight. The primary antibodies used were as follows: PAK1(1:1000, Abclonal, Wuhan, China), Phosphorylated-STAT1 (1:1000, Cell Signaling Technology.Inc, Boston, USA), STAT1 (1:1000, Cell Signaling Technology.Inc, Boston, USA), and GAPDH (1:5000, Bioss, Beijing, China). The next day, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. The protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Biosharp, Hefei, China) and captured using a chemiluminescent assay (LI-COR Biosciences). GAPDH was used as an internal reference.

Immunofluorescence Staining

PDLCs were seeded on coverslips and then treated with 1 μg/ml LPS or normal medium for 24 h. Cultured cells were fixed with 4% paraformaldehyde for 30 min and permeabilized with 0.1% Triton for another 20 min. Afterwards, PDLCs were incubated with primary rabbit polyclonal antibody against PAK1(1:500, Abclonal, Wuhan, China) at 4 °C overnight, followed by incubation with fluorescein isothiocyanate-conjugated secondary antibody (1:10000, Abclonal, Wuhan, China). The coverslips were mounted with an antifluorescence quench reagent containing DAPI. Images were taken with a confocal microscope (Olympus, Japan).

Bioinformatics Analysis

Three different target prediction programs (TargetScan, miRBase and PicTar) were used to identify possible miR-221/222-3p target genes. One of the predicted targets overlapping among all the three databases was further validated in our study.

We first used the UCSC database to determine the sequence of about 1000 bp in length in the upstream promoter region of miR-221/222 gene, and then predicted the potential transcription factors that may bind to this promoter region according to the PROMO database.

Dual Luciferase Reporter Assay

Luciferase reporters containing the wild-type sequence (WT) or mutant sequence (MUT) of PAK1 3’-UTR were constructed (Sangon, Shanghai, China), see Supplementary Fig. 1 for details. HEK293E cells were seeded on 24 well plates and co-transfected with each reporter vector (250 ng) and miR-221-3p or miR-222-3p mimics (40 nM) using Attractant reagent (Qiagen, Germany). After 48 h of transfection, the activity of Renilla luciferase and firefly luciferase was measured using the Dual-Luciferase® Assay System (Promega, USA) according to the manufacturer’s instructions. Renilla luciferase was used as an internal control.

1000 bp upstream of pre-miR-222 was inserted into the pGL3-basic plasmid. Plasmids overexpressing STAT1 and the corresponding empty vector were purchased from Hanbio Biotechnology Co. Ltd. (Shanghai, China). The promoter plasmid was co-transfected into HEK293E cells with STAT1 overexpressed plasmid and pRL-TK plasmid using lipofectamine 3000 (Invitrogen, USA). After 36–48 h of transfection, cells were lysed and measured as described above.

Lentivirus Production and Infection

The plasmids, a PAK1 overexpression plasmid (LV-PAK1) and the empty vector (LV-con), were constructed by Hanbio Biotechnology Co. Ltd. Both were transfected into HEK293E cells along with PMD2G and PSPAX2. After transfection for 72 h, lentivirus particles in the culture supernatant were collected. Then, the culture supernatant were centrifuged. Subsequently, PDLCs were infected with lentivirus particles for 12 h using polybrene. After 48 h, cells in each group were observed under light and fluorescence microscopes. The efficiency of PAK1 overexpression was determined by RT-qPCR and western blot assays.

Chromatin Immunoprecipitation(ChIP)

The ChIP assay was performed using EZ-ChIP™ chromatin immunoprecipitation kit (Millipore, Billerica, MA, USA) according to the manufacturer’s instructions. The purified DNA was analyzed by semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and agarose gel electrophoresis. The primers for RT-PCR were as follows: primer 1 forward: CTTGTCCAAGATACCAGGCTT and reverse: ATGTACATACCTGGGGTGGG; primer 2 forward: AGTGAGGCTTTTCCTAGCCAC and reverse: ATCCTTGCACTCACGGAAGTT; primer 3 forward: AGAGAACACCAATCCTGTGACT and reverse: CAGGTGCTCACTAGCATGTCA; primer 4 forward, ACAAAAATGCTCCAAGCCACA and reverse, TTGGTATGTTTTGCAGTAAAATGGA; primer 5 forward: TACAAGGGGGAGGAATCTGGA and reverse: GGTGGATGGGTAGGGGTAGAT.

Animals

Eighty-six male wistar rats (7 weeks old; weighing 180–220 g) were provided by the Hubei Research Center of Laboratory Animals. All rats were housed under specific pathogen-free conditions with a temperature at 25℃ on a 12-h light/dark cycle and free access to food and water. The animal experiments in this study were approved by the Institutional Animal Care and Use Committee, School & Hospital of Stomatology, Wuhan University (No.00279842). All procedures involving animals were performed according to ARRIVE the guidelines [17].

Establishment of Rat Model of Ligation-Induced Periodontitis

A rat model of periodontitis was established as previously described [18]. Briefly, the rats were anesthetized with an intraperitoneal injection of 3% sodium pentobarbital at a dose of 40 mg/kg. A 4–0 silk ligature was placed around the mandibular first molar of each rat bilaterally to induce experimental periodontitis.

Experimental Design

The experimental design was as follows: i) In order to detect the expression of miR-221/222-3p during experimental periodontitis, 27 Wistar rats were selected and randomly divided into three groups (n = 9 per group). Of these rats, 9 rats were used as the sham-operated group and 9 rats were used to induce experimental periodontitis and were euthanized after ligation placement for 1 week. Another 9 rats were used to induce experimental periodontitis and were euthanized after ligation placement for 3 weeks. The rats were euthanized by an overdose of 3% sodium pentobarbital (100 mg/kg). The gingiva and PDL tissue were dissected from the rats under a stereomicroscope (Leica, Germany). Gingiva surrounding the neck of the tooth was scraped. PDL tissue from the middle third of the rat tooth roots was scraped. The tissues collected from 3 rats were used as one sample and to detect the expression of miR-221/222-3p and inflammatory factors.

ii) For the validation of the overexpression efficiency of miR-221/222-3p in the rat periodontium, miR-221-3p agomir and miR-222-3p agomir were purchased from Suzhou GenePharma Co., Ltd. and dissolved in sterilized PBS at a concentration of 100 nmol/ml. A total of 27 rats were randomly selected and divided into three groups (n = 9 rats per group) as follows: Periodontitis rats administered PBS injection (PD + PBS group), Periodontitis rats administered miR-221-3p agomir injection (PD + agomir-221-3p group); Periodontitis rats administered miR-222-3p agomir injection (PD + agomir-222-3p group). The rats received a subgingival injection of PBS, agomir-221-3p and agomir-222-3p near the ligature at a volume of 20 μl. After 3 days, the rats were euthanized by an overdose of 3% sodium pentobarbital (100 mg/kg). The isolation method of the gingiva and PDL tissue of the rats was performed in the same manner as aforementioned.

iii) To explore whether miR-221-3p or miR-222-3p can attenuate the progression of periodontitis in rats, 32 rats were randomly divided into four groups (n = 8 rats per group) as follows: Sham-operated rats (sham group), Periodontitis rat administered PBS injection (PD + PBS group), Periodontitis rat administered miR-221-3p agomir injection (PD + agomir-221-3p group), and Periodontitis rat administered miR-222-3p agomir injection (PD + agomir-222-3p group). PBS, miR-221-3p agomir or miR-222-3p agomir were injected around the subgingival position near the ligature, respectively, twice a week for 3 weeks following the induction of periodontitis. After 3 weeks, all rats were euthanized by an overdose of 3% sodium pentobarbital (100 mg/kg). The mandibles of the rats were separated, fixed with 4% paraformaldehyde at 4 ℃ for 48 h. For each group, we selected four mandibles for micro-CT analysis and the other four mandibles for hitological detection, randonly.

micro-CT

After removing the ligatures, the extracted mandibles of the rats were immediately immersed in 4% paraformaldehyde and scanned using micro-CT. Subsequently, three-dimensional (3D) images of the lingual view for each sample were visualized using dataviewer software. Alveolar bone loss was measured from the cemento-enamel junction to the alveolar bone crest at three sites (mesio-lingual, lingual and disto-lingual). The delimitation of the region of interest was most mesial to most distal roots of the maximally first molar. The following microstructural parameters were characterized: Bone volume/total volume (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N) and trabecular bone pattern factor (Tb.Sp).

Hematoxylin and Eosin (H&E) Staining and Immunohistochemistry (IHC)

Apart from the samples used for micro-CT scanning, other mandibles of rats were decalcified in 10% EDTA for 3 months. Subsequently, the samples were dehydrated, embedded in paraffin, and sliced into 5-µm-thick sections. The sections were stained with hematoxylin and eosin for histometric analysis.

To detect the expression of IL-6 in periodontal tissue, IHC was performed. Briefly, the tissue sections were incubated with 3% H2O2 to inhibit endogenous peroxidase activity and blocked with 3% BSA for 30 min. The sections were then incubated with an IL-6 primary antibody (1:300, Abclonal, Wuhan, China) overnight. Subsequently, secondary antibodies were added to the slices for 1 h at room temperature. A DAB kit (Maixin, Fuzhou, China) was used to visualize the immunoreactivity. The images were examined and photographed using a light microscope(Leica, Germany). Cells with positive staining were analyzed and counted using Image Pro Plus 6.0 software (Media Cybernetics, USA).

TRAP Staining

To observe the mature osteoclasts in each sample, the TRAP kit (Sigma, USA) was used in the present study as recommended by the manufacturer. TRAP-positive multinucleate cells containing three or more nuclei were counted as osteoclasts. The number of TRAP-positive cells was quantified by imaging five fields of view under × 40 magnification using an inverted phase microscope (Leica, Germany).

Statistical Analysis

All assays in the present study were conducted in triplicate and each experiment was repeated at least three times. Data were analyzed and graphed using GraphPad Prism 6 Software. Statistically significant differences between two groups were assessed using a unpaired Student’s t-test. Multiple group comparisons were performed using one-way ANOVA. All data are presented as the mean ± standard deviation (SD). A value of P < 0.05 was considered to indicate a statistically significant difference.