Mice

C57BL/6J mice were used in this study. Tob-/- mice were generated by Yoshida et al. [49], who describe validation and genotyping methods. The mice were used for preparation of embryonic fibroblasts.

Plasmids

Human cDNA encoding Tob in vector pME18s was generated as previously described [42]. Human Tob and TRAF2 cDNAs were generated by PCR and cloned in plasmid pCMV-HA (635690, Clontech, Mountain View, CA, USA) or pCMV-Flag (635688, Clontech) (Primers for human Tob, forward: GATCGAATTCGGATGCAGCTTGAAATCCAAGTAGCAC, reverse: GATCCTCGAGATTAGTTAGCCATAACAGGCTGGAATTGC. Primers for human TRAF2, forward: ATGCGTCGACCATGGCTGCAGCTAGCGTGAC, reverse: GCATGCGGCCGCTTAGAGCCCTGTCAGGTCCAC). pRK5-human NEMO and pRK5-Flag-human CYLD were as described in [47]. pRK5-Flag-human RIPK1 was kindly obtained from Hiroyasu Nakano (Toho University). pcDNA3.1-Flag-His6-human CYLD (WT), and pcDNA3.1-Flag-His6-human CYLD (C601S) were kindly obtained from Fuminori Tokunaga (Osaka Metropolitan University). pRK5-Flag-human RIPK1 K377R mutants were generated from pRK5-Flag-human RIPK1 using a KOD-Plus mutagenesis kit (SMK-101, TOYOBO, Osaka, Japan) (Primers, forward: GCAGAGTAGACTCCAAGACGAAG, reverse: AGGCTGGGCTCATTCTCTTC). pCMV3-Flag8-SHARPIN (#50014), pCMV3-Flag8-HOIP (#50015), and pCMV3-Flag8-HOIL-1L (#50016) were purchased from Addgene (Cambridge, MA, USA).

Antibodies

The following antibodies were used; anti-p-IκBα (#9246, Cell Signaling Technology (CST), Danvers, MA, USA), anti-IκBα (#9242, CST), anti-p-IKKα/β (#2697, CST), anti-IKKβ (#8943, CST), anti-NEMO (#2685, CST), anti-RIPK1 (#3493, CST), anti-p65 (#8242, CST), anti-phospho-p65 (#3033, CST), anti-p-p38 MAPK (#8690, CST), anti-p-JNK/SAPK (#4671, CST), anti-p-p44/42 MAPK (#9101, CST), and anti-GAPDH (#2118, CST), anti-α-tubulin (T9026, Merck, Darmstadt, Germany), and anti-M2-Flag tag (F1804-1MG, Merck), anti-Flag tag (PM020, MBL, Tokyo, Japan), anti-Myc tag (rabbit IgG, 562-5, MBL), and anti-Myc tag (mouse IgG, M192-3, MBL), anti-CNOT3 (cl.54, Biomatrix, Chiba, Japan), anti-Tob polyclonal for WB (#116163, NovoPro, Shanghai, China), anti-Tob monoclonal antibody for IP and WB was generated our laboratory as described in our previous report [50].

Recombinant proteins

Following recombinant proteins were used for cell stimulation; human TNF-α (210-TA-020, R and D systems, Minneapolis, MN, USA), and mouse TNF-α (410-MT-010, R and D systems), human-IL-1β (200-01B, Peprotech, Rocky Hill, NJ, USA), mouse Flag-tagged TNF-α (ALX-522-009, Enzo Life Sciences, Farmingdale, NY, USA).

Cell culture and transfection

HEK293T, MDA-MB-436, MDA-MB-468, MDA-MB-231, SK-BR3, BT-474, MDA-MB-453, MCF-7, and MEF cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (Merck) and penicillin-streptomycin solution (15140-122, Thermo Fisher Scientific, Waltham, MA, USA). Plasmid transfection into MCF-7 or HEK293T cells was performed with TransIT-LT1 Transfection reagent (V2306, Mirus Bio LCC., Madison, WI, USA) according to the manufacturer’s method using Opti-MEM™ I Reduced Serum Medium (31985062, Thermo Fisher Scientific). siRNA transfection into MCF-7, SK-BR3 or BT-474 cells was performed using Lipofectamine RNAiMax transfection reagent (13778-150, Thermo Fisher Scientific) according to the manufacturer’s method using Opti-MEM™ I Reduced Serum Medium (31985062, Thermo Fisher Scientific). The following target sequences were used: Tob siRNA-1 sense/anti-sense, 5’-CAUUUUGGUAGAGCCGAACTT-3’/5’-GUUCGGCUCUACCAAAAUGTT-3’; Tob siRNA-2 sense/anti-sense, 5’-CAAGGUUGCACGUACUUCUCC-3’/5’-AGAAGUACGUGCAACCUUGUU-3’. Control sense/anti-sense, 5’-UUCUCCGAACGUGUCACGUTT-3’/5’-ACGUGACACGUUCGGAGAATT-3’ from Invitrogen (Carlsbad, CA, USA).

Generation of Tob knockout cells

Guide RNA oligos were selected by Guide Design Resources (https://zlab.bio/guide-design-resources). Forward oligo 5’-caccgCTAAACCCCGATCCTTTGTA-3’ and reverse oligo 5’-aaacTACCCAAAGGATCGGGGTTTAGc-3’ were cloned into pSpCas9(BB)-2A-puro [51]. Cells transfected with guide RNA expression plasmids were selected with 2 μg/mL puromycin 48 h after transfection. Single cells were re-seeded and cultured with DMEM supplemented with 10% heat-inactivated fetal bovine serum as described above. Tob knockout cell lines were verified by western blot and DNA sequencing. To restore Tob expression in Tob KO cells, Tob KO MCF-7 cells were infected with retroviral plasmid pMX-puro carrying human Tob cDNA (pMX-Tob) [42]. In detail, the Platinum-A retroviral packaging cells (2 × 106) (Cell Biolabs, CA, USA) were seeded on 60 mm dish and cultured in DMEM with 10% heat-inactivated fetal bovine serum for 24 h. After the culture medium had been replaced with 5 mL of fresh medium, the transfection was performed with 2 μg of pMXs human-Tob or empty vector plasmid. After 48 h incubation, the supernatant was passed through a 0.45 μm filter and applied to MCF-7 Tob KO cells with 5 μg/mL polybrene (107689, Merck) and added 8 mL culture medium 5 h later. On day 2 following infection, the transduced cells were selected with 5 μg/mL puromycin for 21 days, and then cells were cultured with a culture medium until the experiment.

Immunoprecipitation

Cells were washed with cold PBS and lysed in TNEN buffer (20 mM Tris-HCl [pH7.5], 150 mM NaCl, 1 mM EDTA, 1% NP-40) with PhosSTOP Phosphatase Inhibitor Cocktail (4906837001, Roche, Basel, Switzerland), and Protease Inhibitor Cocktail (EDTA-free) (03969-21, Nacalai tesque, Kyoto, Japan), followed by centrifugation at 16,500 g for 10 min at 4 °C to remove insoluble material. For immunoprecipitation, cell lysates were incubated with 1-2 μg antibodies and protein G-Sepharose (17-0618-02, GE Healthcare, Chicago, IL, USA) or Dynabeads (10004D, Thermo Fisher Scientific, Waltham, MA, USA) at 4 °C. Immunoprecipitants were washed five times with TNEN buffer or 0.05% SDS-contained TNEN buffer. After boiling in 1× SDS sample buffer, samples were subjected to immunoblotting. For TNFR complex I purification, MEFs were seeded at 1.25 × 106 cells per 150 mm dish and treated with 2 μg/mL of Flag-tagged TNF-α. Following the removal of the media, the plates were washed with cold phosphate-buffered saline (PBS) and frozen at −80 °C. The plates were thawed on ice. Cells were lysed with lysis buffer (30 mM Tris-HCl [pH7.5], 120 mM NaCl, 2 mM EDTA, 2 mM KCl, 10% glycerol, 1% Triton X-100, and Phosphatase Inhibitor and Protease Inhibitor Cocktail [EDTA-free] tablets, as indicated), followed by centrifugation at 16,500 g for 10 min at 4 °C to remove the insoluble fraction. Cell supernatants were incubated on a rotating incubator overnight at 4 °C with 20 μL of α-Flag M2 beads (A2220, Merck). For the time 0 samples, 2 μg/mL of Flag-tagged TNF-α was added to post-lysis samples. Beads were washed with lysis buffer four times, and samples were eluted by boiling in 60 μL 1× SDS sample buffer [52].

Immunoblotting

For immunoblotting, immunoprecipitants or cell lysates were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to poly vinylidene fluoride membranes (Immobilon P; Merck). These membranes were incubated with primary antibodies, and immunoreactive proteins were visualized with horseradish peroxidase-conjugated secondary antibodies (GE Healthcare, Chicago, IL, USA) and an ECL Western Blotting Detection System (GE Healthcare). Band intensity was quantified by Image J (National Institutes of Health).

Quantitative real-time reverse transcriptase PCR

Total RNA was isolated from cells using ISOGEN II (311-07361, Nippon Gene, Tokyo, Japan) according to the manufacturer’s method. cDNA was synthesized from 1 μg of RNA with SuperScript III Reverse Transcriptase (18080-085, Thermo Fisher Scientific) according to the manufacturer’s method. Quantitative real-time PCR analysis was performed on a ViiATM7 real-time PCR system (Thermo Fisher Scientific) using SYBR Green reagents (RR820, TaKaRa, Shiga, Japan). The level of GAPDH expression was used to normalize expression data. The following primers were used: human Tob sense/anti-sense, 5’-TCTGTATGGGCTTGGCTTG -3’/5’- GTTGCTGCTGTGGTGGTG -3’ human Il8 sense/anti-sense, 5’-ATGACTTCCAAGCTGGCCGT-3’/5’-TTACATAATTTCTGTGTTGGC-3’; human RelB sense/anti-sense, 5’-ATTTGCCGAATTAACAAGGA-3’/5’-CCTGCTGAACACCACTGATA-3’; mouse RelB sense/anti-sense, 5’- GTGTTCTTGGACCACTTCCT -3’/5’- GAAGCAGGGAAGAAATCAGA -3’; human Nfkbia sense/anti-sense, 5’- TTCAGATGCTGCCAGAGAGT -3’/5’- CCTCCAAACACACAGTCATC -3’;mouse Nfkbia sense/anti-sense, 5’-TGACTTTGGGTGCTGATGT-3’/5’-ATTTCAACAAGAGCGAAACC-3’; human Gapdh sense/anti-sense, 5’-GAAGGTGAAGGTCGGAGTCA-3’/5’-TTGATGGCAACAATATCCACTT-3’; mouse Gapdh sense/anti-sense; 5’-CTGCACCACCAACTGCTTAG-3’/5’-GTCTTCTGGGTGGCAGTGAT-3’.

Data analysis

Microarray analysis of 35 breast cancer cell lines was performed previously [23]. NF-κB activation levels were calculated by EMSA results performed in previous report [6].

Clinical analysis

A hierarchical clustering analysis of publicly available cDNA microarray data derived from 534 primary mammary tumor samples from The Cancer Genome Atlas (tcga-data.nci.nih.gov/) was described previously [26]. Evaluations of NF-κB activation levels were also described in a previous report [26]. GSEA in breast cancer patients was performed with GENI (https://yoavshaul-lab.shinyapps.io/gsea-geni/) [28] using two Breast Invasive Carcinoma cohorts (TCGA, Cell 2015 [27] and PanCancer Atlas) with Hallmark gene sets.

Statistical analysis

Experimental results were expressed as the mean ± SD. The data were subjected to an unpaired Student’s t-test (two-tailed) to determine the statistical significance. Pearson’s correlation coefficient and p-values were calculated by Microsoft excel. Graphs were drawn by GraphPad Prism of Microsoft excel.