INTRODUCTION

The primary cause of gastric cancer (GC) is the bacterium Helicobacter pylori, responsible for 89% of noncardia GCs (1). In the United States, Black patients are being diagnosed with and dying from GC at disproportionate rates compared with White patients, accounting for the greatest Black–White disparity in cancer death rates (2). Because H. pylori is a treatable infection, GC should be a highly preventable cancer. We designed a race-conscious study to understand underlying factors associated with GC disparities in the United States. Although we are opposed to the practice of race-based medicine, race-conscious research is needed to mitigate health inequities (3).

Cytotoxin-associated gene A (CagA) is an established H. pylori virulence factor in the pathogenesis of GC; in previous serological studies of epidemiology cohorts, using blood collected from 1985 to 2009, Black participants were significantly more likely to have cagA antibodies than White participants (4,5). As follow-up to these serologic findings, which reflect any previous exposure (rather than active infection), we sought to determine rates of active cagA-positive H. pylori infections in clinical gastric tissue samples (6). We hypothesized that we would find a greater prevalence of cagA in H. pylori + Black patients than in H. pylori + White patients and that cagA would be associated with H. pylori + gastric intestinal metaplasia (GIM).

METHODS

The Gastric Immune Response and Cancer Interception (also known as GRACE) retrospective cohort comprises H. pylori + patients with archival tissue samples from gastric biopsies obtained during clinical upper endoscopies performed from 2015 to 2019. This cohort was established under an institutional review board (IRB) protocol with waiver of informed consent to access clinical data and archival tissues from endoscopic biopsies. Our analysis was designed to evaluate differences in cagA prevalence in H. pylori + Black patients vs White patients, with race defined as described in the medical record. We sought to include all identified H. pylori + GIM from adult Black or White patients as well as a racially balanced cohort (at least 50% Black patients) of 350 H. pylori + without GIM patients, selected from the total cohort and evenly distributed over the study period of 2015–2019.

Using an electronic query of pathology data, we identified 20,352 upper endoscopies with gastric biopsies performed in our institution from 2015 to 2019, including multiple practice locations and both inpatients and outpatients. Race and ethnicity were identified for these cases using the electronic health record. Information on the number of cases identified and the proportion of Black and White patients undergoing upper endoscopy with gastric biopsies each year are included in Table 1. As reflective of demographics of our local region, 88% of those undergoing upper endoscopy with gastric biopsies were either Black patients or White patients. In the initial study design, in consultation with our statistical team, we understood that because of power limitations, our study design would include oversampling from the 26% of Black patients undergoing upper endoscopy to generate the final cohort, intentionally allowing comparison between Black and White patients.

Table 1. - All upper endoscopies with gastric biopsies 2015–2019 Year Total (all) Black patients (%) White patients (%) 2015 3,240 795 (25) 2,100 (65) 2016 3,753 973 (26) 2,348 (63) 2017 3,960 979 (25) 2,516 (64) 2018 4,476 1,217 (27) 2,710 (61) 2019 4,923 1,306 (27) 2,991 (61) All 20,352 5,270 (26) 12,665 (62)

We queried the pathology reports of histologic findings from endoscopic biopsies using an iterative process to determine keywords and both positive and negative phrases to identify cases with GIM and/or active H. pylori infection. These were clinical cases, and sampling technique was not standardized. Results of keyword searches were combined with manual review to identify all relevant cases while excluding cases with only Barrett's esophagus–type intestinal metaplasia. Once cases with GIM and/or H. pylori were identified, these were assessed for availability of archival blocks with GIM and/or H. pylori. Of the Black and White patients identified with upper endoscopy with gastric biopsies, Table 2 demonstrates the entire subset of GIM patients with active H. pylori infection identified, including all 154 cases identified with both GIM and H. pylori present on histologic assessment of clinical biopsies during the same endoscopic procedure. We found an additional 837 cases in Black and White patients with only active H. pylori (no GIM), and Table 3 demonstrates these cases. Of these, we identified a racially balanced subset of 350 H. pylori cases, randomly selected for each year 2015–2019 by our statistician (T.H.). Further clinical review was performed on all these cases to confirm age, race, specimen availability, and histology findings, with data entered into REDCap (7). Through this process, additional cases were excluded because of age (pediatric cases age <18 years were excluded) or ineligibility because of race/ethnicity or final review of index pathology. After this review, the final cohort for this analysis included 473 patients with active H. pylori infection, including 146 identified cases of H. pylori + GIM and 327 H. pylori + cases. Clinical data extracted for this analysis included demographics such as age, sex, and race.

Table 2. - GIM cases identified with evidence of active Helicobacter pylori on biopsies by year Year Total with GIM and active H. pylori in Black and White patients (all) Black patients with GIM and active H. pylori White patients with GIM and active H. pylori 2015 36 25 11 2016 16 11 5 2017 33 22 11 2018 27 20 7 2019 42 32 10 All 154 110 44
Table 3. - Active Helicobacter pylori cases by year Year Total with active H. pylori and without in Black and White patients (all) Black patients with active H. pylori without GIM White patients with active H. pylori without GIM 2015 146 94 52 2016 171 114 57 2017 165 93 72 2018 180 117 63 2019 175 124 51 All 837 542 295

GIM, gastric intestinal metaplasia.

For each patient, relevant clinical data were entered into a REDCap database, and archival formalin-fixed and paraffin-embedded (FFPE) tissue blocks corresponding to the pathology reports through the BioRepository & Precision Pathology Center (BRPC) were accessed through our BRPC and used to create unstained research slides (Figure 1a). This set of unstained slides was shipped from the BRPC to our collaborator's laboratory for processing under a materials transfer agreement. A research hematoxylin and eosin–stained (H&E) slide was generated from each archival case, and images were obtained in BRPC and uploaded to a research folder. The 2 deidentified unstained slides were used for DNA isolation and droplet digital polymerase chain reaction (ddPCR) using previously developed methods and assays (8) (Table 4). The cagA analysis was performed on the deidentified samples without knowledge of race or clinical data.

Figure 1.:

(a1). Representative H&E-stained section of the research sections created from archival gastric biopsy tissue from endoscopy cases with histologic evidence of Helicobacter pylori used for ddPCR assays. (a2) Images of the paired clinical H&E from the same case with gastric intestinal metaplasia and active H. pylori as reviewed by expert pathologist for clinical diagnosis. (a3) High magnification image from the clinical slide showing active H. pylori infection*. (b) Demographic data for the 473 H. pylori + cases are provided and demonstrate the racial diversity of the cohort as well as results of ddPCR assays for H. pylori and cagA. The H. pylori cohort was selected from 836 cases and designed to include 50% Black patients, whereas all H. pylori + GIM cases were included. (c) When H. pylori + cases with GIM (gray bar, n = 146) and without GIM (black bar, n = 327) were compared, cagA prevalence was increased in those with GIM (*P < 0.0001). (d) The cagA gene was also identified more frequently in Black patients compared with White patients overall and in H. pylori + without GIM and H. pylori+ with GIM (see [b] for sample size of each group) (*P < 0.0001). CagA and cagA, protein and gene names for cytotoxin-associated gene A; ddPCR, droplet digital PCR; GIM, gastric intestinal metaplasia.

Table 4. - Primer/probe list for Helicobacter pylori–specific droplet digital PCR in a multiplex assay to detect both the 16S rRNA gene (to detect H. pylori) and the cagA gene; the EPIYA region of cagA was assessed as a second assay for cagA Target/assay Primer/probe name Primers/probe H. pylori 16S 16S-F
16S-R
16S-HEX 5′–GCGACCTGCTGGAACATTAC–3′
5′–CGTTAGCTGCATTACTGGAGA–3′
5′ HEX–AAGCCCTCCAACAACTAGCATCCAT–BHQ1 3′ CagA CagA-F
CagA-R
CagA-FAM 5′–TGGCTCAAGCTCGTGAAT–3′
5′–TGGAAAACTTGAACGAATCAGA–3′
5′ FAM–CTTCCYACATTATGYGCAACKATC–BHQ1 3′ EPIYA EPIYA-C/D-F
EPIYA-Fv2
EPIYA-C/D-R
EPIYA-Rv2
EPIYA C-HEX
EPIYA D-FAM 5′–TCAGTTAGCCCTGAACC–3′
5′–TCAACTAGCCCTGAACC–3′
5′–GCCCTACCTTACTGAGAT–3′
5′–GCCCTACCTTACTGAGAT–3′
5′ HEX–TCCGCCGAGATCATCAATCGTAGC–BHQ1 3′
5′ FAM–AAGCCTGCTTGATTTGCCTCATCAAA–BHQ1 3′

In the primer/probe list, Y = equal mix of C,T. K = equal mix of G,T.

CagA and cagA, protein and gene names for cytotoxin-associated gene A.

To isolate DNA from two 10-μm unstained FFPE slides, the slides were scraped and washed into a microcentrifuge tube with 1-mL xylene. Residual xylene was removed by washing with 1-mL 100% ethanol twice and 95% ethanol once. Samples were dried at 37 °C while shaking. DNA from the resulting dried pellet was extracted using Qiagen AllPrep DNA/RNA FFPE Kit (Cat # 80234) according to the manufacturer's instructions with the following modifications: 2 sources of proteinase K were used for extraction in equal volumes (proteinase K provided in kit and Sigma #3115828001). Incubation at 56 °C after pellet rehydration with a digestion buffer for FFPE samples (buffer PKD [Qiagen]) was performed for 1 hour while shaking. Centrifugation after rehydration step was performed at 4 °C. DNA was eluted with 65 μL of elution buffer (buffer ATE [Qiagen]).

H. pylori–specific ddPCR assays were performed using a QX200 ddPCR System (Bio-Rad) with previously described primers and probes on DNA samples extracted from FFPE tissues (Table 4) (8). All samples were tested with a multiplex assay to detect both the 16S rRNA gene (to detect H. pylori) and the cagA gene. To account for the higher genetic diversity of cagA compared with the 16S gene, we also assayed all H. pylori 16S positive samples with a second assay targeting the EPIYA region of cagA (8). Thermal cycling conditions were 95 °C for 10 minutes, 45 cycles of 94 °C for 30 seconds, 55 °C for 1 minute, and 1 cycle of 98 °C for 10 minutes. Samples were run in duplicate. 16S/cagA assays were run with 10 μL of sample, and EPIYA (Glu-Pro-Ile-Tyr-Ala sequence) assays were run with 5 μL of sample per reaction. Data were analyzed using QuantaSoft software, version 1.6.6 (Bio-Rad). The thresholds for positive droplets were calculated based on the average droplets of the negative control plus 6 times the SD using previously defined methods (9). Samples were considered positive for H. pylori if there were more than an average of 5 positive droplets in the H. pylori 16S assay; cagA positive was defined as positive in either the cagA or the EPIYA assay (or both).

Analyses were performed using the χ2 test to compare H. pylori cagA gene presence by disease status (H. pylori + without GIM vs H. pylori+ with GIM), by race, and by race within each disease group.

RESULTS

As designed, Black and White patients were equally represented among the H. pylori + without GIM cohort; however, among the population of all identified H. pylori+ with GIM, 73% were Black patients (Figure 1b). Sensitivity of the ddPCR assay was high in this cohort with known active H. pylori infection: H. pylori was identified by ddPCR in 94% of H. pylori + patients without GIM and in 90% of H. pylori + GIM patients. Evidence of cagA was present in 62% of all patients and was more frequently found in patients with H. pylori + GIM (77%) compared with H. pylori + without GIM (56%) (P < .0001) (Figure 1c). Comparing overall cagA prevalence by race, we found that Black patients were significantly more likely to have cagA + H. pylori than White patients (82% vs 36%, P < .0001) (Figure 1d). By disease status, we found the same patterns of cagA + by race: Among patients with H. pylori + without GIM, cagA was identified in 79% of Black patients vs 33% of White patients (P < .0001); among those with H. pylori + GIM, cagA was identified in 87% of Black patients vs 50% of White patients (P < .0001) (Figure 1d).

DISCUSSION

In a diverse cohort in the southeastern United States, we found a significant difference by race in the prevalence of cagA in gastric tissue samples of patients with active H. pylori infection. We also found that cagA was more common in patients with active H. pylori infection and GIM compared with patients with active H. pylori infection without GIM, building on previous work demonstrating the association between cagA and more advanced histologic findings and GIM (10,11). Our findings that precancerous H. pylori + GIM disproportionately affected Black patients are especially relevant when interpreted in the context of GC disparities at our institution, where 24% of patients undergoing endoscopy are Black, and 62% of those diagnosed with GC are Black, mirroring the national trend of increased GC incidence in Black patients.

Although the single-center nature of this study is a limitation, the validated molecular analysis of cagA in 473 clinical gastric tissue samples is a strength. Moreover, the high rates of cagA in active infections demonstrate that high-risk H. pylori infections represent an ongoing challenge, despite knowledge of racial disparities in cagA serology having been previously established (5). Our results are particularly compelling because active H. pylori infection is a modifiable risk factor, and H. pylori eradication is associated with reduced GC risk (12). Understanding the high rates of cagA in patients undergoing endoscopy with active H. pylori infection, and the strong association of cagA with both race and risk of progression to GC, makes effective treatment a compelling future focus (13).

Although we work as a healthcare community to ensure better access to and delivery of high-quality healthcare, gastroenterologists can ensure that we identify H. pylori infections in all patients who meet criteria for H. pylori testing (any history of peptic ulcer disease, gastric mucosa-associated lymphoid tissue (MALT) lymphoma, GIM or GC, dyspepsia, before nonsteroidal anti-inflammatory drug (NSAID) or aspirin use, iron deficiency anemia, idiopathic thrombocytopenic purpura, Lynch syndrome, and family history of GC), followed by guideline-concordant treatment as a clinical strategy to reduce both virulent cagA-positive H. pylori infections and GC disparities. Eradication testing offers an additional opportunity for practice improvement (14–16). As work continues to address GC disparities, research is also needed to understand the role of systemic racism in the perpetuation of H. pylori infections in the community as well as current limitations in healthcare access and delivery. In addition, in the future, clinical molecular testing for factors associated with GC risk, such as cagA, could offer more personalized strategies to H. pylori and GIM management (17).

CONFLICTS OF INTEREST

Guarantor of the article: Katherine S. Garman, MD.

Specific author contributions: M.E.: study concept and design, acquisition of data, analysis and interpretation of data, drafting of the manuscript, and critical revision of the manuscript for important intellectual content; S.J.M.: acquisition of data, interpretation of data, and critical revision of the manuscript for important intellectual content; F.W.: analysis and interpretation of data; critical revision of the manuscript for important intellectual content; P.A.: acquisition of data, interpretation of data, and critical revision of the manuscript for important intellectual content; H.B.: acquisition of data, interpretation of data, and critical revision of the manuscript for important intellectual content; J.W.: acquisition of data and critical revision of the manuscript for important intellectual content; C.L.: interpretation of data and critical revision of the manuscript for important intellectual content; R.Z.: interpretation of data and critical revision of the manuscript for important intellectual content; C.C.: acquisition of data and critical revision of the manuscript for important intellectual content; M.D.: acquisition of data, interpretation of data, and critical revision of the manuscript for important intellectual content; T.H.: study concept and design, analysis and interpretation of data, and critical revision of the manuscript for important intellectual content; S.P.: study concept and design, interpretation of data, and critical revision of the manuscript for important intellectual content; N.S.: study concept and design, acquisition of the data, drafting of the manuscript, and critical revision of the manuscript for important intellectual content; K.S.G.: study concept and design, acquisition of data, interpretation of data, drafting of the manuscript, and critical revision of the manuscript for important intellectual content.

Financial support: This study was funded by a grant from the National Cancer Institute, US National Institutes of Health, as part of the Duke Cancer Health Disparities P20 (P20 CA251657) and the Duke Cancer Institute as well as by the National Institute of Diabetes and Digestive and Kidney Diseases (Garman R01 DK135169).

Potential competing interests: None to report.

Study Highlights

WHAT IS KNOWN ✓ Gastric cancer is associated with marked health disparities in the United States and prior serologic studies suggested racial disparities in exposure to the Cytotoxin-associated gene A (CagA) H. pylori virulence factor, known to be assocuated with increased risk of gastric cancer.

WHAT IS NEW HERE ✓ In a diverse cohort in the Southeastern United States, in patients with active Helicobacter pylori infection at the time of upper endoscopy, Black patients were significantly more likely to have evidence of cagA + H. pylori (82% vs 36%), P < 0.001). ACKNOWLEDGEMENTS

The authors acknowledge the Duke University BioRepository & Precision Pathology Center (BRPC) and the Biostatistics Shared Resource, both supported by the Cancer Center Support Grant (P30 CA014236) as their core services were essential parts of this project.

REFERENCES 1. de Martel C, Georges D, Bray F, et al. Global burden of cancer attributable to infections in 2018: A worldwide incidence analysis. Lancet Glob Health 2020;8(2):e180–e190. 2. Giaquinto AN, Miller KD, Tossas KY, et al. Cancer statistics for African American/Black people 2022. CA Cancer J Clin 2022;72(3):202–29. 3. Barrett-Campbell O, DeGroote M, Lansigan F. Race and ethnicity-conscious clinical research best practices. JAMA Oncol 2022;8(10):1391–2. 4. Butt J, Blot WJ, Shrubsole MJ, et al. Differences in antibody levels to H. pylori virulence factors VacA and CagA among African Americans and Whites in the Southeast USA. Cancer Causes Control. 2020;31(6):601–6. 5. Varga MG, Butt J, Blot WJ, et al. Racial differences in Helicobacter pylori CagA sero-prevalence in a consortium of adult cohorts in the United States. Cancer Epidemiol Biomarkers Prev. 2020;29(10):2084–92. 6. Basso D, Zambon CF, Letley DP, et al. Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology. 2008;135(1):91–9. 7. Harris PA, Taylor R, Thielke R, et al. Research electronic data capture (REDCap): A metadata-driven methodology and workflow process for providing translational research informatics support. J Biomed Inform 2009;42(2):377–81. 8. Talarico S, Safaeian M, Gonzalez P, et al. Quantitative detection and genotyping of Helicobacter pylori from stool using droplet digital PCR reveals variation in bacterial loads that correlates with cagA virulence gene carriage. Helicobacter. 2016;21(4):325–33. 9. Trypsteen W, Vynck M, De Neve J, et al. ddpcRquant: threshold determination for single channel droplet digital PCR experiments. Anal Bioanal Chem 2015;407(19):5827–34. 10. Sozzi M, Valentini M, Figura N, et al. Atrophic gastritis and intestinal metaplasia in Helicobacter pylori infection: The role of CagA status. Am J Gastroenterol. 1998;93(3):375–9. 11. Saruc M, Demir MA, Kucukmetin N, et al. Histological and clinical predictive value of determination of tissue CagA status by PCR in Helicobacter pylori infected patients; results of the large population based study in western Turkey. Hepatogastroenterology. 2002;49(45):878–81. 12. Li D, Jiang SF, Lei NY, et al. Effect of Helicobacter pylori eradication therapy on the incidence of noncardia gastric adenocarcinoma in a large diverse population in the United States. Gastroenterology. 2023;165(2):391–401.e2. 13. Chey WD, Leontiadis GI, Howden CW, et al. ACG clinical guideline: Treatment of Helicobacter pylori infection. Am J Gastroenterol. 2017;112(2):212–39. 14. Feder R, Posner S, Qin Y, et al. Helicobacter pylori-associated peptic ulcer disease: A retrospective analysis of post-treatment testing practices. Helicobacter. 2018;23(6):e12540. 15. Kumar S, Metz DC, Kaplan DE, et al. Low rates of retesting for eradication of Helicobacter pylori infection after treatment in the veterans health administration. Clin Gastroenterol Hepatol. 2021;19(2):305–13.e1. 16. Lee JY, Kim N. Diagnosis of Helicobacter pylori by invasive test: Histology. Ann Transl Med. 2015;3(1):10. 17. Huang RJ, Ende AR, Singla A, et al. Prevalence, risk factors, and surveillance patterns for gastric intestinal metaplasia among patients undergoing upper endoscopy with biopsy. Gastrointest Endosc 2020;91(1):70–7.e1.