Ethics

All studies were approved by the Medical Ethics Committee of Jiangsu University and Ethics Committee for Experimental Animals of Jiangsu University (IRB approval protocol number: 2020161). The obtainment of human umbilical cords was approved by the Medical Ethics Committee of Maternal and Child Health Hospital in Zhenjiang (201701).

Isolation and identification of hucMSCs and hucMSC-sEV

The isolation and identification of hucMSCs were conducted as previously described (Qiao et al. 2008). When hucMSCs were cultured to P2 generation, the cells were seeded into plates and induced to osteogenesis (Cyagen Biosciences, HUXUC-90021) and adipogenesis (Cyagen Biosciences, HUXUC-90031). When hucMSCs were cultured to P5 generation, flow cytometry (Beckman Coulter, Cytoflex) was used to measure the surface markers.

The supernatant of hucMSCs was collected and hucMSC-sEV was extracted through ultracentrifugation (Beckman, XPN-100) as previously described (Sun et al. 2022). Briefly, the conditioned medium was centrifugated for 30 min at 2000 g and 10,000 g, respectively. Afterwards, the supernatant was concentrated with 100 kDa MWCO hollow fiber membrane (Millipore, USA) followed by centrifugated for 3 h at 100,000 g. The hucMSC-sEV were dissolved in PBS and kept at 4℃ overnight. Then the samples were identified through Western blot, Nanoparticle tracing analysis (Particle Metrix, 220-Twin), and Transmission electron microscopy analysis (HITACHI, H-7800).

MiRNA sequencing, electroporation, and labeling of hucMSC-sEV

The miRNA sequence was analyzed by Illumina Hiseq (Oebiotech, Oe2015H1459). Differentially expressed miRNAs were analyzed with a significance threshold of P value < 0.05. The miRNA expression of hucMSC-sEV and HFL1-sEV was compared and screened out the higher expression of miRNA in hucMSC-sEV, especially miR-13896 (NC_000020.11_miR-13896, UGGUCUGGACUGCUGAGGGG).

The powder of miR-13896 mimic NC, mimic, inhibitor NC, and inhibitor was purchased from GenePharma (Suzhou, China) and dissolved with DEPC water according to the protocols. Mimic NC, mimic, inhibitor NC, or inhibitor was mixed with hucMSC-sEV in the electrode cup and electroporated using the machine (Bex, CUY21EDITII). The mass ratio of reagent and hucMSC-sEV was 1:180. The mixture was kept in the incubator for 1 h to restore membrane integrity. Then the mixture was washed 30 min through 100 kDa MWCO hollow fiber membrane at 2000 g for two times. The procedure was shown in Fig. S1.

DIL dye (Thermo, D3911) and hucMSC-sEV were mixed at the ratio of 1:200 and shaked for 2 h. Afterward, the mixture was washed 30 min through 100 kDa MWCO hollow fiber membrane at 2000 g for several times. DIL-labeled hucMSC-sEV were administered to the AKI mice by the tail vein with 1 × 1010 particles, and small animals in vivo imaging (PerkinElmer, USA) was used to detect the organ distribution of hucMSC-sEV at 24 h.

Cisplatin-induced AKI model and treatment

Male ICR mice (20 ± 2 g) were purchased from the Animal Research Center of Jiangsu University (Zhenjiang, China). All animal experiments were compliant with standard guidelines for the care and use of laboratory animals. The establishment of animal model was conducted as previous described (Wu et al. 2022). The mice were randomly divided into seven groups (n = 6): control group, cisplatin-induced AKI group, hucMSC-sEV group, mimic NC-loaded sEV (sEV-mimic NC) group, mimic-loaded sEV (sEV- mimic) group, inhibitor NC-loaded sEV (sEV-inhibitor NC) group, and inhibitor-loaded sEV (sEV-inhibitor) group. Briefly, the mice were intraperitoneal injected with 10 mg/kg cisplatin (Sigma, P4394). After 3rd and 4th day, hucMSC-sEV, sEV-mimic NC, sEV- mimic, sEV-inhibitor NC, and sEV-inhibitor groups containing 1 × 1010 particles were injected through the tail vein. Finally, the mice were sacrificed and the kidney tissues and serum were collected on the 5th day.

Western blot

HucMSC-sEV and cells were lysed with RIPA lysis buffer (Pierce, 89,901). Then, 100 μg protein samples were added into the 12% SDS–polyacrylamide gels. Afterward, the proteins were transferred to the PVDF membrane (Millipore, IPVH00010). After blocked with 5% skim milk for 2 h, the membrane was incubated with primary antibodies overnight as follows: anti-Alix (Abcam, ab117600), anti-TSG101 (Abcam, ab125011), anti-CD63 (Abcam, ab271286), anti-Calnexin (CST, 26,795), anti-iNOS (CST, 13120S), anti-Arg1 (CST, 93668S), anti-β-actin (Abclonal, AC026), anti-Tradd (Abclonal, A1145), anti-p65 (Wanlei, WL01273b), anti-p-p65 (Wanlei, WL02169). After washing three times, the secondary antibody (Invitrogen, 31,460) was incubated at 37℃ for 1 h. The protein bands were visualized using the chemical gel imaging system (ImageQuant LAS4000 mini).

Real-time fluorescence quantification RT-PCR (qRT-PCR)

RNAs from cells were obtained using Trizol Reagent (Vazyme, R401-01). And RNAs from hucMSC-sEV were obtained using Qiazol (Qiagen, 217,184). cDNA was synthesized with a commercial reverse transcription kit (Vazyme, R312-01/02) according to the manufacture’s protocols. Then the primers were designed and the expression of genes were detected using a SYBR Green PCR kit (Vazyme, Q511-02). The sequences of primers are listed in Table S1.

ELISA

Mouse mononuclear macrophage leukemia cells (RAW264.7 cells) were cultured in high-glucose DMEM (Bioind, 06–1055-57-1ACS) containing 10% fetal calf serum (Excell, FSP-500). The culture supernatant of RAW264.7 cells was centrifugated to remove cells and collected. The concentration of IL-1β (Multi-Science, EK201B/3–01), IL-6 (Multi-Science, EK206/3–01) and IL-10 (Multi-Science, EK210/4–04) was quantified through the establishment of a series of standard substance according to the manufacturer’s protocols.

Hematoxylin and eosin staining, immunofluorescence and immunohistochemistry

The tissue sections underwent a dewaxing process. Hematoxylin and eosin (HE) staining was prepared according to protocols. Scoring is conducted based on the degree of tubular injury, categorized into five grades: grade 0–4. Grade 0: less than 5% injured renal tubules. Grade 2: 5–25% injured renal tubules. Grade 3: 25–75% injured renal tubules. Grade 4: more than 75% injured renal tubules affected. Finally, the scores from ten fields of view are averaged to calculate the tubular necrosis score index. For the immunofluorescence, the sections were incubated with primary antibodies overnight: anti-F4/80 (Huabio, RT1212), anti-iNOS (CST, 13120S), anti-Arg1 (CST, 93668S), anti-Bax (Wanlei, WL01637), anti-PCNA (Wanlei, WL03213), anti-Tradd (Abclonal, A1145), and anti-p65 (Abclonal, A2547). The secondary antibodies were goat anti-rat Cy3 monoclonal antibody (Bioworld, BS10009) and goat anti-rabbit FITC monoclonal antibody (SAB, L3202). And the nuclear was stained with Hoechst33342 (Sigma, B2261). Finally, the images were observed under the microscope (Olympus, U-RFL-T). For the immunohistochemistry, the sections were incubated with F4/80 antibody (CST, 30325 T) and applied SABC kit to react under microscopy (Boster, SA1020).

Reactive oxygen species assay

RAW264.7 cells were seeded in the 6-well plates at a density of 3 × 104 cells/cm2. When the cell density reached 60–70%, the cells were pre-stimulated with 1 μg/ml LPS for 12 h. Then hucMSC-sEV were added into the plate with 1 × 1010 particles/ ml for one day. After treatment, the diluted probe DCFH-DA was added and incubated for 20 min at 37℃. The cells were washed three times and observed under the microscope (Solarbio, CA1410).

Flow cytometry

RAW264.7 cells were seeded in the 6-well plates and treatment with 1 μg/ml LPS. Afterward, M0 and M1 macrophages were under fixation, membrane disruption, and incubation with Brilliant Violet 421™ anti-CD86 antibody (Biolegend, 105,031) and Alexa Fluor® 488 anti-CD206 antibody (Biolegend, 141,710). Flow cytometry (Beckman Coulter, Cytoflex) was applied to measure CD86 and CD206.

Human renal tubular epithelial cells (HK2 cells) were cultured in DMEM/F12 (Meilunbio, MA0214-2) and seeded in the 6-well plates. Afterwards, they were treated with 2 μg/ml cisplatin to induce injury. The supernatant of RAW264.7 cells in the Control group (Rcon), LPS group (Rlps), and HucMSC-sEV group (RsEV) were collected and added in HK2 cells for one day. Then HK2 cells were digested and stained according to detection kit (Vazyme, A211-01). Flow cytometry (Beckman Coulter, Cytoflex) was applied to measure apoptosis.

Transfection

Mimic NC, mimic, inhibitor NC and inhibitor of miR-13896 were purchased from Genepharma (Suzhou, China). RAW264.7 cells were seeded in 6-well plates at a density of 3 × 104 cells/cm2 followed by stimulation with 1 μg/ml LPS (Sigma, L2630) and transfected when the confluence is 70%−80%. For each plate, the reduced serum medium is 1 ml with 2.5 μl lipo2000 (Invitrogen, 11,668,019) and 5 μl mimic or inhibitor. The medium was changed to normal serum medium after 6 h. Two days after transfection, the protein and RNAs were extracted to explore relevant research.

Dual-luciferase reporter experiment

The wild or mutant 3’UTR region of Tradd mRNA was designed and cloned into miRNA Target Expression Vector by Genepharma (Suzhou, China). HEK293T cells were cultured in high-glucose DMEM (Bioind, 06–1055-57-1ACS) containing 10% fetal calf serum (Excell, FSP-500) and were seeded in 24-well plates. When the confluence reaches 70%−80%, the empty vector, wild type, and mutant vector were co-transfected with mimic NC and mimic in HEK293T cells. After two days, the luciferase activities were measured by Dual-luciferase Reporter Assay (Vazyme, DL101-01) according to the protocols.

Statistical analysis

The data were shown as mean ± standard deviation (SD). Data analysis was performed using GraphPad Prism software (GraphPad Software 8.0, USA). Unpaired Student’s t-test, One-way ANOVA, and Tukey’s test were applied to compare the differences between the groups. P < 0.05 was considered a significant difference.