Item does not exist

Geniposide alleviates post-myocardial infarction-induced pyroptosis by modulating the thioredoxin-interacting protein/NLRP3 signaling pathway

INTRODUCTION

Myocardial infarction (MI) represents a consequential outcome of myocardial ischemia, which results in cell death. This outcome is highly important and should not be overlooked.[1] Myocardial ischemia leads to insufficient oxygen supply to cardiac muscles, which triggers myocardial hypoxia, culminates in apoptotic and necrotic cell death, and ultimately manifesting as MI.[2] MI induces a robust inflammatory response, which fosters cell death, cardiac dysfunction, and alterations in the ventricular remodeling.[3] Further, exploration of this phenomenon revealed that pyroptosis, also known as cell inflammatory necrosis, plays an instrumental role in triggering the inflammatory cascade following MI.[4,5] Pyroptosis is characterized by continuous cell enlargement, which culminates in cell membrane rupture, triggers the release of intracellular contents, and induces an inflammatory reaction.[6] This process is primarily triggered by the inflammasome-mediated activation of caspase-1 and other caspases and subsequent cleavage of gasdermin D (GSDMD).[7] GSDMD, a pore-forming protein within the GSDMD family, functions as an essential initiator of pyroptosis.[8] Thioredoxin-interacting protein (TXNIP) interacts with nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) and participates in inflammasome activation and subsequent pyroptosis.[9] When cells are stimulated by danger signals, excessive reactive oxygen species (ROS) production generates TXNIP, which is originally bound to thioredoxin (TRX), to dissociate and bind to the leucine-rich repeat domain of NLRP3, which initiates and activates the NLRP3 inflammasome.[10-13] This process promotes the generation of active caspase-1, GSDMD, interleukin (IL)-18, and IL-1β.[14] The release of these cytokines exacerbates cellular damage and inflammation. Pyroptosis following myocardial ischemia shows a close association with the severity of myocardial injury. On one hand, cytokines and inflammatory mediators released during pyroptosis further damage on the surrounding myocardial tissue, which exacerbates ischemic injury. On the other hand, pyroptosis adversely affects myocardial regeneration and repair processes, which hinders the recovery of damaged myocardial tissue. Therefore, the regulation of pyroptosis holds important clinical implications.

Recent studies have indicated that certain natural products can potentially inhibit cell pyroptosis and reduce myocardial ischemic damage. Geniposide (GP) protects myocardial cells from pyroptotic damage.[15] This compound is a primary active component of Gardenia jasminoides Ellis[16,17] and possesses diverse pharmacological properties, including antioxidant stress,[18] anti-inflammatory properties,[19] anti-apoptotic effects,[20] antithrombotic activity,[21] anti-endoplasmic reticulum stress,[22] and antifungal properties.[23] Our research group previously reported that GP, through the activation of glucagon-like peptide-1 receptors, inhibits oxidative stress in hypoxia-reoxygenation myocardial cells (reducing ROS/reactive nitrogen species), enhances mitochondrial membrane potential, reduces mitochondrial calcium overload, and improves mitochondrial dysfunction.[18] Moreover, to further explore the role of GP in ischemia-reperfusion injury (RI), our group established a MI/RI model in our preliminary work. Pretreatment with GP considerably improved cardiac function and structure in MI/RI rats and reduced the myocardial cell pyroptosis rate.[24] However, our group did not investigate the effects of GP on inflammation and cell pyroptosis following MI nor the specific mechanisms of GP in the TXNIP/NLRP3 signaling pathway. Therefore, this study aimed to examine the influence of GP on the cell pyroptosis triggered by MI and elucidate its mechanisms of action. We used animal and cell models to evaluate the inhibitory effects of GP on myocardial cell pyroptosis in vivo and in vitro and assessed changes in the TXNIP/NLRP3 signaling pathway. This work also elucidated the regulatory role of GP in the TXNIP/NLRP3 signaling pathway in myocardial ischemic damage and provides new therapeutic strategies and drug targets for post-MI treatment.

MATERIAL AND METHODS Experimental animals

Our study included 64 male 8-week-old specific pathogen free (SPF)-grade C57BL/6J wild-type mice, with mouse each weighing between 18 and 20 g (Chongqing Ensiweier Biological Technology Co., Ltd). In addition, our animal facilities adhered to a 12 h light-dark cycle, which ensured the unrestricted access of mice to water and food. Ambient temperature was kept between 23°C and 25°C. After a 1-week acclimation period, participation of the mice in the experiment commenced.

All animal procedures employed in the project were approved by Institutional Animal Care and Use of Chongqing Medical University, Approval number: IACUC-CQMU-2023-0315.

Experimental model

The anesthetic procedure for our MI model group mice was conducted as follows: We intraperitoneally injected the mice with 50 mg/kg sodium pentobarbital (0.3%) to ensure that they were anesthetized. Subsequently, a custom-made intubation device was inserted into the trachea to assist in ventilation. The mice were securely fastened to the surgical platform with their chests depilated. Next, thoracotomy was performed on the left side between the third and fourth ribs to expose the heart. A suture needle was then passed through the ligature to ligate the root of the left anterior descending coronary artery. Finally, the thoracic cavity was promptly closed, and suturing was performed.

The control group (sham) underwent the following procedures: A similar MI model operation was performed, but thoracotomy was conducted without ligating the root of the left anterior descending coronary artery.

Group dosing and sampling of experimental animals

Experimental Assessment of GP’s Effect on Post-MI cardiac pyroptosis:

Control group: Following surgery, daily oral administration of 0.2 mL saline was continued for 14 consecutive days.

MI Group: Postsurgery, daily oral administration of 0.2 mL saline was sustained for 14 consecutive days.

MI+low-dose GP Group (MI + L + GP): After surgery, daily oral administration of GP at 50 mg/kg (drug concentration 5 mg/mL, 0.2 mL/dose) was maintained for 14 days.

MI+high-dose GP Group (MI + H + GP): Postsurgery, daily oral administration of GP at 100 mg/kg (drug concentration 10 mg/mL, 0.2 mL/dose) was continued for 14 consecutive days (8 mice per group).

Experimental evaluation of NLRP3’s Role in GP-mediated pyroptosis inhibition

Control Group: An open-chest surgery was performed with the anterior descending branch ligation omitted. Postoperatively, saline was orally administered on a daily basis.

MI: Following MI induction, saline was orally administered daily.

MI+GP group: After the induction of MI, daily oral administration of GP at 100 mg/kg was administered.

MI+GP+NLRP3 inhibitor (MCC950) group (MI + GP + MCC950): After MI induction, daily oral administration of GP (100 mg/kg) was combined with intraperitoneal injection of 10 mg/kg MCC950 (A421651-0002, Sangon Biotech, Shanghai, China) (8 mice per group).

After a 14-day period, euthanasia was performed using high-concentration CO2. Subsequently, blood serum was collected, and further analysis involved the retrieval of the heart and lungs tissues.

Mouse physiological and cardiac structure and function assessment

We conducted measurements on various groups of mice at four different time points on days 0, 3, 7, and 14. These measurements included monitoring of the body weight, heart rate, and blood glucose levels. In addition, the relative weights of the heart, wet lung, and dry lung in each group of mice were calculated. Furthermore, cardiac ultrasonography was performed to assess the structural and functional aspects of the heart. Transthoracic echocardiography was performed using a VividTM E95 echocardiogram system (GE Healthcare, Boston, MA, USA). The mice were anesthetized with 2% isoflurane and positioned on the echo platform in the left lateral decubitus position. To maintain their core body temperature, we heated the platform to 37°C. After placement, the fur on the chest was gently removed using a hair removal cream. Heart rate, which typically ranges 400 bpm–500 bpm, was determined from cardiac cycles. L8-18i-D PROBE ultrasound probe (GE Healthcare, Boston, MA, USA) was placed in parasternal view at the level of papillary muscles to capture short-axis images of the heart. M-Mode imaging was then performed to measure the end systolic volume (ESV), end diastolic volume (EDV), left ventricular internal diameter at systole (LVIDs), and left ventricular internal diameter at diastole (LVIDd). The left ventricular ejection fraction (EF) was calculated as (EDV − ESV)/EDV, and the left ventricular fractional shortening (FS) was (LVIDd − LVIDs)/LVIDd. All measurements were conducted by an investigator who was unaware of the treatment conditions.

Triphenyltetrazolium chloride (TTC) staining

The TTC staining method was employed to assess the extent of MI in the left ventricular tissue of mouse hearts. Freshly harvested mouse myocardial tissues were rinsed with sterile saline (ST341–500 mL, Beyotime, Shanghai, China) and then frozen at −20°C for 20 min. After freezing and starting from the apex, the tissues were serially sliced into thin sections with thicknesses not exceeding 1 mm. These sections were then immersed in 2% TTC staining solution (Sigma, St. Louis, Missouri, USA) and incubated at 37°C in a light-protected environment for 20 min. Following incubation, the tissues were fixed with 4% paraformaldehyde (p0099, Beyotime, Shanghai, China), and photographs were captured after 8 h. The infarcted myocardial area was calculated using Image-Pro Plus Version 6.0 software (Media Cybernetics, Rockville, Maryland, USA).

Hematoxylin–eosin (HE) staining

HE staining was performed to determine the overall structure and inflammation status of the left ventricular tissue in mouse hearts. Initially, left ventricular tissue samples were prepared by cleaning and fixing the tissue sections. Subsequently, a series of procedures, including dehydration, transparency, and paraffin embedding, was performed to create paraffin sections. The paraffin sections were rehydrated to restore their aqueous state. For specific staining effects, we conducted HE staining using G1004 (Servicebio, Wuhan, China) and G1002 (Servicebio, Wuhan, China) to highlight distinct cell components. Then, ethanol dehydration and transparency treatments were conducted, followed by reinforcement of the sections with neutral resin. Then, images of the stained sections were captured using an optical microscope (MF53, Mshot-Mingmei, Guangzhou, China). This sequence of steps facilitated the observation and documentation of the microstructure and inflammatory conditions of the cardiac tissue.

Terminal deoxynucleotidyl transferase (TdT) 2’-deoxyuridine 5’-triphosphate nick end labeling (TUNEL) staining

TUNEL assay was performed to investigate pyroptosis in myocardial cells. During the experiment, we used a Diaminobenzidine (DAB) (Streptavidin-horse radish peroxidase [SA-HRP]) TUNEL Cell Apoptosis Detection Kit (G1507, Servicebio, Wuhan, China) to assess cardiac cell pyroptosis. After deparaffinization and rehydration of the paraffin sections, incubate the sections with proteinase K working solution for 20 min, Equilibration Buffer for 10 min, TdT incubation buffer for 1 h, and StreptavidinHRP reagent for 30 min. After each incubation step, wash the samples 3-4 times with phosphate buffered saline (PBS) solution, 5 min each time. Then, we performed DAB staining (ZLI-9019; ZSGB-BIO, Beijing, China) and observed the staining patterns. Next, the sections were stained with hematoxylin solution (G1004, Servicebio, Wuhan, China) for 1 min, thoroughly washed with distilled water, differentiated briefly in hematoxylin differentiation solution for approximately 2 s, immediately rinsed with distilled water, washed with tap water for 10 min to achieve bluing, and finally rinsed with distilled water. After staining, the sections were dehydrated and mounted. Finally, the sections and capture images were observed using an inverted microscope (Mshot MF53, Mshot-Mingmei, Guangzhou, China). The apoptosis rate was calculated using ImageJ (version 1.53, Wayne Rasband, National Institutes of Health, https://imagej.nih.gov/ij/), with the average apoptosis rate being the mean of apoptosis rates from three images.

Quantitative polymerase chain reaction (qPCR)

During this experimental phase, we employed qPCR to assess the expressions of type I collagen (Col I), Col III, TXNIP, and NLRP3 mRNA, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serving as the internal reference. Relative expressions, which indicate fold differences in the target gene expressions between the experimental and control groups, were assessed through the 2−△△Ct method. Table 1 lists the polymerase chain reaction primer sequences.

Table 1: Primer sequences.

Primers Sequences Col I-F GCAAGAGGCGAGAGAGGTTT Col I-R GACCACGGGCACCATCTTTA Col II-F GAGGAATGGGTGGCTATCCG Col II-R TCGTCCAGGTCTTCCTGACT TXNIP-F CAATCAGTAGGCGGGTCTCC TXNIP-R TGTTCTGACATCCACCCAGC NLRP3-F AAGGCTGCTATCTGGAGGAACT NLRP3-R ATACAGCCTTTCTCGGGCG m-GAPDH-F GGAGAGTGTTTCCTCGTCCC m-GAPDH-R TTTGCCGTGAGTGGAGTCAT Western blot (WB)

WB assay was conducted to evaluate the protein levels of TXNIP, NLRP3, caspase-1, and GSDMD N-terminal (GSDMD-N) in myocardial tissue. Initially, a small quantity of cardiac tissue sample was placed in 2 mL grinding tubes, and radioimmunoprecipitation assay lysis buffer (P0013B, Beyotime, Shanghai, China) was added to extract proteins. Protein concentration was quantified through the bicinchoninic acid assay. The protein samples were then combined with ×5 sodium dodecyl sulfate (SDS) loading buffer (G2083, Servicebio, Wuhan, China), heated in a boiling water bath to denature, and separated by 10% SDS-polyacrylamide gel electrophoresis (PAGE). The gel was transferred onto a polyvinylidene fluoride membrane (10600023, Cytiva, Shanghai, China), which was then placed in Tris buffered saline with Tween 20 (TBST) buffer and blocked with 5% skim milk at room temperature for 1 h. Next, primary antibodies, including TXNIP (1:1,000), NLRP3 (1:1,000), caspase-1 (1:1,000), GSDMD-N (1:1,000), and GAPDH (1:1,000), were used (ABclonal Company in Wuhan, China; A9342, A5652, A0964, A20197, and A19056, respectively). Incubation with the primary antibodies was performed overnight on a shaker at 4°C. Subsequently, the secondary antibody, horse radish peroxidase (HRP) goat antirabbit Immunoglobulin G IgG (H + L) (AS014, ABclonal, Wuhan, China), was diluted at a ratio of 1:2,000 in TBST and incubated at room temperature for 1 h. Immunoreactivity was detected using an enhanced chemiluminescence reagent (34580, Thermo, Massachusetts, USA) and imaged using a nucleic acid and protein gel imaging system (Universal Hood II, Bio-Rad, CA, USA). The grayscale values of the bands were analyzed using ImageJ (version 1.53, Wayne Rasband, National Institutes of Health, https://imagej.nih.gov/ij/). This analysis determined the relative protein expressions through calculation of the ratio of the target protein’s grayscale value to that of GAPDH.

Immunohistochemistry (IHC)

IHC was used to detect the protein levels of Col I and Col III in myocardial tissue. The involved procedure included deparaffinization and rehydration of paraffin sections, antigen retrieval by boiling, treatment with 3% hydrogen peroxide, PBS washing, incubation with the blocking serum, overnight primary antibody (1:200), secondary antibody (1:50), DAB chromogen staining, counterstaining with hematoxylin, differentiation, dehydration with ethanol and xylene, and mounting with neutral resin. The slides were examined for blue-stained nuclei and brown-yellow positive areas under a microscope. Imaging was conducted using an Mshot MF53 inverted microscope (Guangzhou Mingmei Optoelectronics Technology Co., Ltd).

Primary antibody: Col I/COL1A1 rabbit pAb (A1352, ABclonal, Wuhan, China), Col III antibody (Orb10437, Biorbyt, Wuhan, China); secondary antibody: HRP-labeled goat anti-rabbit IgG (H + L) (A0208, Beyotime, Shanghai, China).

Immunofluorescence (IF)

IF method was used to assess the expression and localization of TXNIP and NLRP3 proteins in the myocardial tissue. Paraffin-embedded sections were initially deparaffinized and rehydrated, subjected to antigen retrieval through boiling for 30 min, and allowed to cool to room temperature. Subsequently, the sections were incubated for 30 min with a goat serum at room temperature for blocking, followed by the removal of excess blocking solution without rinsing. The sections were subsequently incubated overnight at 4°C with primary antibodies targeting NLRP3 (R381207, Zenbio, Chengdu, China) and TXNIP (R382206, Zenbio, Chengdu, China) at a 1:200 dilution. Following primary antibody incubation, a secondary antibody solution, Cy3 goat antirabbit IgG (H + L) (AS007, ABclonal, Wuhan, China) diluted at 1:200, was applied and treated at room temperature for 1.5 h under light-shielded conditions. Next, 4’,6-diamidino-2-phenylindole (DAPI) staining was carried out through the addition of DAPI solution and incubated for 5 min under light protection to stain the cell nuclei. The cells were rinsed with PBS to remove excess DAPI. Finally, all sections were covered with an autofluorescence quenching agent, and images were captured using an inverted microscope (Mshot MF53, Mshot-Mingmei, Guangzhou, China).

Enzyme-linked immunosorbent assay (ELISA)

The ROS levels in mouse myocardial tissue were assessed using a mouse ROS ELISA Kit (CB10366-Mu, COIBO BIO, Shanghai, China).

Cell culture

Isolation of primary cardiomyocytes:[25] Hearts were harvested from 1 to 3-day-old SPF-grade C57BL/6J wild-type mice. The chest was disinfected with 70% ethanol and opened along the left sternum, and the heart was removed. The heart was rinsed with cold PBS to remove the atria and blood vessels. The rinsed heart tissue was then placed in 0.06% trypsin (S310KJ, Basal media, Shanghai, China) and incubated at 4°C for 5 h to loosen the tissue. The heart tissue was then transferred to a centrifuge tube with a digestion solution of 0.1% Col II (17101015, Thermo, Massachusetts, US) and 0.5% bovine serum albumin, cut into 1 mm3 fragments, and incubated for digestion. The supernatant was collected, and the cells were seeded into culture dishes. After differential adherence, cells from the culture medium were collected, counted, adjusted to a density of 1 × 105 cells/mL, and then seeded into a six-well plate. Cell morphology and contraction were observed under an inverted microscope, and before the experiments, the purity of cardiomyocytes was confirmed by α-actin fluorescence ≥90%. Cell lines underwent regular mycoplasma contamination screening and were evaluated through short-tandem repeat DNA profiling.

Establishment of the chronic hypoxia (CH) model

Primary cardiomyocytes were seeded into cell culture flasks or plates and cultured until 70–80% confluence. The cells were washed thrice with serum-free Dulbecco’s Modified Eagle Medium (DMEM)/F12 (C11995500BT, GIBCO, Massachusetts, US) and then incubated with 4 mL serum-free DMEM/F12 in a hypoxic chamber (1% oxygen, 5% Carbon dioxide) at 37°C for an appropriate period to induce hypoxia. After 48 h of hypoxia, the CH model was established.

Virus construction and cell transfection

The lentivirus p-Receiver-TXNIP was produced using full-length human TXNIP complementary deoxyribonucleic acid segment which was cloned into the lentiviral vector p-Receiver-Lv185, and 293T cells (CRL11268, ATCC, Virginia, US). When cardiomyocytes reached 70–80% confluence in culture, they were infected with the lentivirus.

Cell experiment groups

Investigation of the effect of GP on CH-induced cardiomyocyte apoptosis:

Control group: Primary cardiomyocytes cultured under normal conditions.

Control + GP group: GP added at a concentration of 40 µM to the cardiomyocyte culture under normal conditions.

CH group: Cardiomyocytes cultured to 70–80% confluence and subjected to the CH model established through the method described above.

GP + CH group: GP added at a concentration of 40 µM to the cardiomyocyte culture for 30 min of pretreatment followed by establishment of the CH model.

Investigation of whether GP attenuates CH-induced cardiomyocyte apoptosis by inhibiting the TXNIP/NLRP3 signaling pathway:

Control group: Cultured in blank culture medium.

CH + overexpression-negative control (oe-NC) group: Cardiomyocytes cultured to 70–80% confluence and subjected to the CH model.

CH + -TXNIP group: Cardiomyocytes infected with lentivirus overexpressing TXNIP followed by establishment of the CH model.

CH + OE-TXNIP + GP group: Cardiomyocytes infected with lentivirus overexpressing TXNIP and treated with GP followed by establishment of the CH model.

Cell counting kit-8 (CCK-8) assay

Using the same batch of cardiomyocytes, the cell suspension density was adjusted to 1 × 105 cells/mL. Then, 100 µL of this suspension was dispensed into each well of a 96-well plate, with five replicate wells per group. The plate was placed in a standard cell culture incubator, and the cells were incubated until they reach 70–80% confluence. The cells were treated in accordance with each group’s requirements. Then, the culture medium was replaced with 100 µL CCK-8 (C0038, Beyotime, Shanghai, China) solution per well and incubated in a 37°C cell culture incubator for 2 h. The 96-well plate was transferred to a microplate reader (CMax Plus, Molecular Devices, California, US), the instrument parameters were set, and the absorbance was measured at 450 nm for each well. The cell viability for each group was determined using the recorded absorbance values.

Transmission electron microscopy (TEM)

Observation of cell necrosis morphology through electron microscopy revealed the following: enlarged, deformed, and swollen cells, ruptured membrane, distorted organelles, irregular DNA degradation, and intact nuclei. Cells were collected, washed with PBS, digested with trypsin, and centrifuged, and fixed in centrifuge tubes containing glutaraldehyde and osmium tetroxide. Sequential dehydration with acetone was performed, followed by infiltration and embedding in epoxy resin (Epon 812). Ultrathin sections approximately 50 nm thick were prepared, followed by double staining (uranyl acetate and lead citrate), and observed through TEM (JEM-1400PLUS, JEOL, Tokyo Metropolis, Japan).

ELISA

ELISA methods were used to quantify the levels of IL-1β, IL-18, lactate dehydrogenase (LDH), and creatine kinasemuscle/brain (CK-MB) levels were measured using the mouse IL-1β ELISA Kit (EK201B/3–96, MultiSciences [LiankeBio], Hangzhou, China), IL-18 levels with a mouse IL-18 ELISA Kit (EK218–96, MultiSciences [LiankeBio], Hangzhou, China), LDH levels with the mouse LDH ELISA Kit (CB10587-Mu, COIBO BIO, Shanghai, China), and CKMB levels with the mouse CK-MB ELISA Kit (CB10373-Mu, COIBO BIO, Shanghai, China).

Immunoprecipitation (IP)

IP was performed to verify the interaction between TXNIP and TRX, and their association with the NLRP3 inflammasome. Cell proteins were extracted and adjusted to a concentration of 200 µg/mL. IP was performed separately using antibodies against TXNIP (R382206, Zenbio, Chengdu, China) and TRX (ab273877, Abcam, Cambridge, UK). The samples were incubated with the respective antibodies in IP buffer for 12 h, mixed with 20 µL protein A/G agarose beads, and incubated at room temperature for an additional 4 h. After washing the beads with IP buffer, the immunoprecipitated proteins were resuspended in the SDS sample buffer, boiled for 3 min, and analyzed by SDS-PAGE.

Data statistics and analysis

The experimental data acquired in this study are portrayed as mean ± standard error. Group comparisons were executed through the one-way analysis of variance, and data analysis and graphical representation were facilitated through GraphPad Prism 8 software (GraphPad Software Inc., La Jolla, California, USA) (www.graphpad.com). Variances were considered statistically significant whenever a parameter presented P < 0.05.

RESULTS Effects of GP on cardiac indices, cardiac structure and function, and MI area in MI mice

We monitored the mice at multiple time points, including days 0, 3, 7, and 14, focusing on their weight, heart rate, and blood glucose levels. Our results reveal the significant weight change in the MI group compared with the control group. (P < 0.01), and the heart rate significantly increased on days 0, 7, and 14 (P < 0.05, P < 0.01, P < 0.001, respectively). The blood glucose levels in the MI group also increased on day 14 (P < 0.05). Subsequently, observations were made following GP treatment, which indicate that no significant changes occurred in weight or blood glucose levels across all groups. However, in the MI + L + GP and MI + H + GP groups, the heart rate significantly increased on day 3 (P < 0.001), and it notably decreased on day 14 in MI + H + GP group (P < 0.01) [Figure 1a-c]. No significant differences were observed in wet lung and dry lung relative weights among the groups [Figure 1d and e]. The MI group exhibited a significant increase in relative heart weight (P < 0.01) [Figure 1f]. In addition, the area of heart infarction significantly increased in the MI group (P < 0.001), whereas it markedly decreased in the MI + L + GP, MI + H + GP groups (P < 0.01) [Figure 1g and h]. Ultrasound assessment of heart structure and function revealed a significant decline in EF (Teich) and %FS in MI group (P < 0.001). However, after GP treatment, compared with the MI group, the MI + L + GP and MI + H + GP groups exhibited a significant improvement in EF (Teich) and %FS (P < 0.001). No significant differences were observed in the heart rate among the groups [Figure 1i]. This finding suggests that GP can improve the symptoms of MI in mice.

Effects of Geniposide (GP) treatment on physiological indicators and heart infarct size in myocardial infarction (MI) mice (n = 8). (a) Weight, (b) heart rate, (c) blood glucose, (d) wet lung relative weight, (e) dry lung relative weight, (f) heart relative weight, (g and h) heart infarct size, and (i) heart structure and function. Compared with the control group, ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001; compared with the MI group, ##P < 0.01, ###P < 0.001; compared with the MI + Low (L)-GP group, ^^P < 0.01, ^^^P < 0.001. Figure 1: Effects of Geniposide (GP) treatment on physiological indicators and heart infarct size in myocardial infarction (MI) mice (n = 8). (a) Weight, (b) heart rate, (c) blood glucose, (d) wet lung relative weight, (e) dry lung relative weight, (f) heart relative weight, (g and h) heart infarct size, and (i) heart structure and function. Compared with the control group, ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001; compared with the MI group, ##P < 0.01, ###P < 0.001; compared with the MI + Low (L)-GP group, ^^P < 0.01, ^^^P < 0.001.

Export to PPT

GP’s effects on cardiac histomorphology and cardiomyocyte pyroptosis

Pathological examination of the myocardium revealed the following: In the control group, the myocardial tissue structure showed no evident abnormalities. The myocardial fibers were cord-like and displayed a tight arrangement, with intact myocardial cell structures and distinct boundaries. In the MI group, the orderly arrangement of myocardial fibers was lost and became loosely arranged with a significant increase in fibrous tissue. Damaged, deformed, swollen, and ruptured myocardial cell structures were observed, with noticeable inflammatory cell infiltration. The MI + L + GP group exhibited disorganized myocardial tissue structure, pronounced myocardial cell swelling, reduced inflammatory cell infiltration, and tissue hemorrhage. Compared with the MI group, the extent of damage was considerably alleviated. In the MI + H + GP group, the myocardial fibers were continuously arranged but were slightly loose in structure. Although myocardial cells exhibited swelling, their morphological structure remained largely intact [Figure 2a].

Myocardial tissues of each group of mice were subjected to hematoxylin–eosin (HE) and terminal deoxynucleotidyl transferase 2’-deoxyuridine 5’-triphosphate nick end labeling (TUNEL) staining (scale bar = 50 µm) (n = 3). (a) HE (×200), (b) TUNEL (×200). Compared with the control group, ✶✶✶P < 0.001; compared with the myocardial infarction (MI) group, ###P < 0.001; compared with the MI + L-Geniposide group, ^^P < 0.01. Figure 2: Myocardial tissues of each group of mice were subjected to hematoxylin–eosin (HE) and terminal deoxynucleotidyl transferase 2’-deoxyuridine 5’-triphosphate nick end labeling (TUNEL) staining (scale bar = 50 µm) (n = 3). (a) HE (×200), (b) TUNEL (×200). Compared with the control group, ✶✶✶P < 0.001; compared with the myocardial infarction (MI) group, ###P < 0.001; compared with the MI + L-Geniposide group, ^^P < 0.01.

Export to PPT

TUNEL staining results of the control group displayed minimal positive reactions. However, in the MI group, a substantial increase in the number of TUNEL-positive cells occurred within myocardial cells. In comparison with the MI group, MI + L + GP and MI + H + GP groups exhibited a significant decrease in the TUNEL-positive cell rate (P < 0.001). In comparison with the MI + L-GP group, the MI + H + GP group exhibited a further significant decrease in the TUNEL-positive cell rate (P < 0.01) [Figure 2b]. This result suggests that GP can alleviate MI-induced apoptosis.

Effects of GP on the level of Col I/Col III/pyroptosis-related genes in myocardial tissue

Figure 3a illustrates the effect of GP on the expressions of Col I, Col III, TXNIP, and NLRP3 mRNA in myocardial tissue. The MI group exhibited significant increases in Col I, Col III, TXNIP, and NLRP3 mRNA levels compared with the control group (P < 0.001). By contrast, the MI + L + GP and MI + H + GP groups demonstrated the notably reduced expressions of these markers compared with those of the MI group (P < 0.001). Moreover, the MI+H+GP group showed further significant decreases in the Col I, Col III, TXNIP, and NLRP3 mRNA levels compared with the MI + L + GP group (P < 0.05, P < 0.01, and P < 0.001, respectively).

Expressions of type I collagen (Col I)/type III collagen (Col III)/apoptosis-related genes in mouse myocardial tissues of each group (n = 3). (a) Quantitative polymerase chain reaction assessed the expression of Col I, Col III, thioredoxin-interacting protein (TXNIP), and NLRP3 mRNA. (b) Western blot evaluated protein expressions of TXNIP, NLRP3, caspase-1, and gasdermin D N (GSDMD-N)-terminal. (c) Immunohistochemistry (IHC) staining detected the protein expression levels of Col I and Col III (IHC: ×200, scale bar = 50 µm). Compared with the control group, ✶✶✶P< 0.001; as compared with the myocardial infarction (MI) group, #P < 0.05, ##P < 0.01, ###P < 0.001; as compared with the MI+L-Geniposide (L-GP) group, ^P < 0.05, ^^P < 0.01, ^^^P < 0.001. NLRP3: NOD-like receptor protein 3, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, H-GP: High geniposide. Figure 3: Expressions of type I collagen (Col I)/type III collagen (Col III)/apoptosis-related genes in mouse myocardial tissues of each group (n = 3). (a) Quantitative polymerase chain reaction assessed the expression of Col I, Col III, thioredoxin-interacting protein (TXNIP), and NLRP3 mRNA. (b) Western blot evaluated protein expressions of TXNIP, NLRP3, caspase-1, and gasdermin D N (GSDMD-N)-terminal. (c) Immunohistochemistry (IHC) staining detected the protein expression levels of Col I and Col III (IHC: ×200, scale bar = 50 µm). Compared with the control group, ✶✶✶P< 0.001; as compared with the myocardial infarction (MI) group, #P < 0.05, ##P < 0.01, ###P < 0.001; as compared with the MI+L-Geniposide (L-GP) group, ^P < 0.05, ^^P < 0.01, ^^^P < 0.001. NLRP3: NOD-like receptor protein 3, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, H-GP: High geniposide.

Export to PPT

Figure 3b demonstrates the influence of GP on the levels of TXNIP, NLRP3, caspase-1, and GSDMD-N proteins in myocardial tissue. The MI group showed marked increases in the levels of TXNIP, NLRP3, caspase-1, and GSDMD-N compared with the control group (P < 0.001). By contrast, the MI + L + GP and MI+H+GP groups exhibited significant reductions in these proteins compared with the MI group (P < 0.05, P < 0.01, and P < 0.001, respectively). In addition, the MI+H+GP group displayed a further significant decrease in TXNIP, NLRP3, caspase-1, and GSDMD-N levels compared with the MI + L + GP group (P < 0.05).

Figure 3c illustrates the effect of GP on the levels of Col I and Col III proteins in myocardial tissue. The MI group exhibited a significant increase in Col I and Col III compared with the control group (P < 0.001). However, the MI + H + GP group showed a notable reduction in Col I levels compared with the MI group (P < 0.001). The MI + L + GP and MI + H + GP groups demonstrated significant decreases in Col III levels relative to the MI group (P < 0.001). Furthermore, the MI + H + GP group experienced further significant reductions in Col I and Col III compared with the MI + L + GP group (P < 0.01).

Role of NLRP3 in GP-mediated pyroptosis resistance

We explored the effect of MCC950 on the expression of NLRP3, TXNIP, caspase-1, GSDMD-N, and ROS levels in cardiac tissues [Figure 4].

Effects of NOD-like receptor protein 3 (NLRP3) inhibitors on the expression of NLRP3, thioredoxin-interacting protein (TXNIP), caspase-1, gasdermin D N-terminal (GSDMD-N), and reactive oxygen species (ROS) levels in cardiac tissue during Geniposide (GP)-mediated anti-pyroptosis (n = 3). (a) mRNA level of NLRP3, TXNIP; (b) expression of caspase-1 and GSDMD-N; (c and d) NLRP3 (Immunofluorescence [IF]: ×400, scale bar = 50 µm) and TXNIP (IF: ×400, scale bar = 50 µm); (e) ROS. Compared with the control group, ✶✶✶P < 0.001; as compared with the myocardial infarction (MI) group, ##P < 0.01, ###P < 0.001; as compared with the MI + GP group, ^P < 0.05, ^^^P < 0.001. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, DAPI: 4’,6-diamidino-2-phenylindole, MCC950: NLRP3 inhibitor. Figure 4: Effects of NOD-like receptor protein 3 (NLRP3) inhibitors on the expression of NLRP3, thioredoxin-interacting protein (TXNIP), caspase-1, gasdermin D N-terminal (GSDMD-N), and reactive oxygen species (ROS) levels in cardiac tissue during Geniposide (GP)-mediated anti-pyroptosis (n = 3). (a) mRNA level of NLRP3, TXNIP; (b) expression of caspase-1 and GSDMD-N; (c and d) NLRP3 (Immunofluorescence [IF]: ×400, scale bar = 50 µm) and TXNIP (IF: ×400, scale bar = 50 µm); (e) ROS. Compared with the control group, ✶✶✶P < 0.001; as compared with the myocardial infarction (MI) group, ##P < 0.01, ###P < 0.001; as compared with the MI + GP group, ^P < 0.05, ^^^P < 0.001. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, DAPI: 4’,6-diamidino-2-phenylindole, MCC950: NLRP3 inhibitor.

Export to PPT

In the MI group, myocardial tissue exhibited significantly elevated levels of NLRP3, TXNIP, caspase-1, and GSDMD-N compared with those in the control group (P < 0.001). By contrast, the MI + GP group showed significant reductions in these markers compared with the MI group (P < 0.001, P < 0.01). In addition, the MI + GP + MCC950 group demonstrated a further decrease in NLRP3, caspase-1, and GSDMD-N levels compared with the MI + GP group (P < 0.001, P < 0.05). [Figure 4a-d] provided detailed results. Furthermore, ROS levels in the cardiac tissues of the MI group were significantly higher compared with those of the control group (P < 0.001). The MI + GP group exhibited a substantial reduction in the ROS levels compared with the MI group (P < 0.001). The MI + GP + MCC950 group also demonstrated a significant decrease in the ROS levels (P < 0.001). [Figure 4e] shows the detailed results.

Effect of GP on myocardial cell necrosis induced by CH

In the control + GP group, myocardial cell viability, IL-1β and IL-18 levels and LDH and CK-MB levels remained unchanged compared with the control group (P > 0.05). By contrast, the CH group exhibited a significant reduction in myocardial cell viability (P < 0.01) and notable increases in IL-1β (P < 0.01) and IL-18 (P < 0.001) levels, along with elevated levels of LDH and CK-MB (P < 0.001). Compared with the CH group, the GP + CH group showed a significant improvement in myocardial cell viability (P < 0.05) and a marked decrease in IL-1β and IL-18 (P < 0.05) levels and lower LDH (P < 0.01) and CK-MB (P < 0.001) levels [Figure 5a-c]. The mitochondria of CH group cells revealed significant shrinkage and deformation, membrane rupture, and matrix leakage, with an enlarged intermembrane space of intact mitochondria, which indicates severe necrosis. After GP treatment, the mitochondria displayed deformation, membrane rupture, and matrix leakage but not the enlargement of the intermembrane space. These findings suggest that although GP cannot completely reverse the effects of necrosis, it can alleviate CH-induced myocardial cell necrosis to some extent [Figure 5d].

Effect of geniposide (GP) on myocardial cell necrosis induced by chronic hypoxia (CH) (n = 3). (a) Cell counting kit-8 detected cell viability; (b and c) enzyme-linked immunosorbent assay-detected interleukin (IL)-1β, IL-18, lactate dehydrogenase, and CK-MB; (d) Transmission electron microscopy-detected cell pyroptosis. N: Nucleus, Mi: Mitochondria, ASS: Autophagolysosome, RER: Rough endoplasmic reticulum, red arrow: Mitochondrial membrane rupture, green arrow: Mitochondrial deformation, yellow arrow: Enlargement of the mitochondrial intermembrane space. Compared with the control group, ✶✶P < 0.05, ✶✶✶P < 0.001; as compared with the CH group, ##P < 0.01, ###P < 0.001. Compared with the control group; “ns” stands for no significant difference. CK-MB: Creatine kinase-myocardial band levels, LDH: Lactate dehydrogenase. Figure 5: Effect of geniposide (GP) on myocardial cell necrosis induced by chronic hypoxia (CH) (n = 3). (a) Cell counting kit-8 detected cell viability; (b and c) enzyme-linked immunosorbent assay-detected interleukin (IL)-1β, IL-18, lactate dehydrogenase, and CK-MB; (d) Transmission electron microscopy-detected cell pyroptosis. N: Nucleus, Mi: Mitochondria, ASS: Autophagolysosome, RER: Rough endoplasmic reticulum, red arrow: Mitochondrial membrane rupture, green arrow: Mitochondrial deformation, yellow arrow: Enlargement of the mitochondrial intermembrane space. Compared with the control group, ✶✶P < 0.05, ✶✶✶P < 0.001; as compared with the CH group, ##P < 0.01, ###P < 0.001. Compared with the control group; “ns” stands for no significant difference. CK-MB: Creatine kinase-myocardial band levels, LDH: Lactate dehydrogenase.

Export to PPT

GP inhibits TXNIP/NLRP3 signaling pathway to counter CH-induced myocardial cell necrosis

Compared with the control group, the CH + oe-NC group showed a significantly reduced myocardial cell viability (P < 0.001), accompanied with elevated levels of IL-1β (P < 0.01), IL-18 (P < 0.01), LDH (P < 0.001), and CKMB (P < 0.001). The CH + oe-TXNIP group revealed further reduction in myocardial cell viability (P < 0.001), alongside even higher levels of IL-1β (P < 0.01), IL-18 (P < 0.05), LDH (P < 0.001), and CK-MB (P < 0.001). These results imply that oe-TXNIP exacerbated the myocardial cell necrosis induced by CH. Compared with the CH + oe-TXNIP group, the GP + CH + oe-TXNIP group presented a significantly increased myocardial cell viability (P < 0.001), accompanied with decreased levels of IL-1β (P < 0.001), IL-18 (P < 0.01), LDH (P < 0.001), and CK-MB (P < 0.001) [Figure 6a-c]. Electron microscopy revealed no abnormal morphology and clear internal structure in the control group. In the CH + oe-NC group, the cells exhibited considerable mitochondrial shrinkage and deformation, membrane rupture, matrix leakage, and a large number of autophagic lysosomes. The CH + oe-TXNIP group displayed extensive mitochondrial rupture and signs of shrinkage in the intact mitochondria, with blurred membrane structures and an increase in autophagic lysosomes. However, after GP treatment, only a few mitochondria showed rupture, mitochondrial shrinkage disappeared, and the content of autophagic lysosomes decreased, which indicate the reduced degree of cell dama

Comments (0)

No login
gif