Antibodies

The antibodies used in this study were listed as follows: CD81 (Abcam, Cambridge, MA, USA, ab109201, 1/5000), TSG101 (Abcam, ab125011, 1/5000), CD9 (Abcam, ab236630, 1/1000), TRIM25 (Abcam, ab167154, 1/10000), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Abcam, ab9485, 1/2500), Runt-related transcription factor 2 (Runx2; Abcam, ab236639, 1/1000), osteocalcin (OCN; Abcam, ab133612, 1/5000), Janus kinase (JAK)1 (Abcam, ab133666, 1/5000), signal transducer and activator of transcription (STAT)6 (Abcam, ab32108, 1/5000), phospho(p)-JAK1 (Abcam, ab138005, 1/5000), p-STAT6 (Abcam, ab263947, 1/1000), p65 (Abcam, ab32536, 1/5000), inhibitor of kappa B alpha (IκBα; Abcam, ab32518, 1/5000), p-p65 (Abcam, ab76302, 1/1000), p-IκBα (Abcam, ab92700, 1/1000), triggering receptor expressed on myeloid cell (TREM)1 (Abcam, ab200729, 1/5), Toll-like receptor (TLR)4 (Abcam, ab13556, 1/1000), ubiquitination (PTM Biotechnology Co., LTD, Hangzhou, China, PTM-1106RM, 1/1000), goat-anti-rabbit secondary antibody (Abcam, ab6721, 1/10000).

Cell culture

Human BMSCs obtained from Ji’ning Shiye Biotechnology Co. LTD (Shanghai, China) were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/high glucose (HyClone, China) supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillin and 100 mg/mL streptomycin at 37 °C and 5% CO2.

Human osteoblasts were purchased from Procell Life Technology Co., Ltd. (Wuhan, China). The specific protocol for culturing human osteoblasts can be found in the study by (Yang et al. 2022). Human bone marrow-derived macrophages (BMDMs) were also purchased from Procell Life Technology Co., Ltd. (Wuhan, China). They were cultured in a specific culture medium designed for BMDMs, also provided by Procell. Human embryonic kidney (HEK)-293T cells were obtained from Procell Life Technology Co., Ltd. (Wuhan, China). These cells were cultured in Minimum Essential Medium (MEM) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin. All cells were maintained in an incubator set at 37 °C with 5% CO2. The culture medium was replaced every three days to ensure optimal growth conditions.

To inhibit the release of Exos from BMDMs, the exosome inhibitor GW4869 (10 µM; Sigma-Aldrich, St. Louis, MO, USA) was added to the culture medium of BMDMs. The cells were then cultured for 48 h at 37 °C with 5% CO2, following the protocol described by (Yang et al. 2019). To explore the effects of BMSC-derived Exos on macrophage polarization and osteogenic differentiation, co-culture experiments were performed using a transwell system. BMDMs were co-cultured with BMSCs in a transwell system for 48 h at 37 °C with 5% CO2. The transwell system allows for the exchange of soluble factors between the two cell types without direct cell-to-cell contact. BMDMs were co-cultured with human osteoblasts in a transwell system for 48 h at 37 °C with 5% CO2. This setup is used to assess the impact of macrophage polarization on osteogenic differentiation.

BMSCs characterization

To determine the multipotential differentiation capacity of BMSCs, BMSCs were seeded in 12-well plates at a density of 1.5 × 104 cells/cm2 in DMEM/high glucose medium. Once the cells reached 80% confluence, the medium was changed to osteogenic differentiation medium. This medium contains: 1 nM dexamethasone, 50 μM L-ascorbic acid-2-phosphate, 20 mM β-glycerophosphate. The osteogenic differentiation medium was purchased from Cyagen Biosciences (Guangzhou, China). After the induction period, the osteogenic differentiation potential was analyzed by Alkaline phosphatase (ALP) staining and Alizarin Red S (ARS) staining. Following the research protocol of Li et al. (Li et al. 2023), BMSCs were cultured in adipogenic differentiation medium. The adipogenic differentiation potential was analyzed by Oil Red O staining to detect lipid droplets.

For detecting stem cell surface markers, BMSCs were were blocked with 3% bovine serum albumin (BSA, Beyotime Biotechnology Co., Ltd, Shanghai, China) for 30 min and stained with antibodies against Sca-1 (ab124688, Abcam), CD44 (BD, USA, 550989), CD-34 (BD, 560710), and CD-45 (BD, 560975) at 4 ℃ for 30 min. Finally, a flow cytometer (Accuri C6, BD Biosciences, San Jose, CA) was applied for the examination of labeled cells.

ALP staining

The ALP staining assay was performed using a commercial ALP staining kit (Solarbio Biotechnology Co. LTD, Beijing, China) according to the instructions. BMSCs or osteoblasts were washed with PBS and fixed with ALP fixative for 3 min. After that, the cells were incubated with ALP staining solution for 20 min without light. After washing the cells with PBS, osteogenic differentiation of BMSCs was imaged by microscopy, and the osteogenic differentiation capability of osteoblasts was directly photographed.

ARS staining

ARS staining was performed using a Mineralized nodules Staining kit (Beyotime). BMSCs or osteoblasts were fixed by 4% paraformaldehyde (PFA) for 20 min and then washed by PBS thrice. Next, ARS staining solution was added to the cells to make the cells completely covered to stain the cells at room temperature for 30 min. Finally, the staining results of BMSCs or osteoblasts were analyzed under the microscope or directly photographed, respectively.

ALP activity detection

Firstly, the osteoblasts were rinsed with PBS thrice, lysed in Radio Immunoprecipitation Assay (RIPA) solution (Beyotime), and finally centrifuged at 12,000 g for 10 min at 4 °C to remove cellular debris at 4 °C. Next, ALP activity in the samples was measured by a commercial ALP Assay kit (Beyotime) according to the manufacturer’s protocol. Finally, the staining outcome was analyzed under the microscope.

Oil red O staining

In brief, 0.05 g of oil red O powder (Sigma) was added to 99% propanediol (Sigma) to prepare oil red O dyes. After removing the culture medium, BMSCs were washed with 1 mL of PBS twice. Next, the cells were fixed with 4% PFA in PBS for 15 min at room temperature. After removing the solution, the cells were washed with ddH2O three times, and 0.5% oil red O was added to incubate the cells for 1 h at room temperature. After incubation, the cells were washed with 70% ethanol (Beyotime) three times and analyzed under a microscope.

Extraction and identification of Exos from human BMSCs

Exos were isolated using sequential ultracentrifugation as described previously (Yue et al. 2022). Initially, BMSC culture medium underwent centrifugation steps at 500 g for 10 min, 2000 g for 10 min, and 10,000 g for 30 min to eliminate cell debris and large organelles. Exos were subsequently collected from the supernatants through ultracentrifugation at 100,000 g for 70 min using a 50.2Ti rotor in a Beckman Coulter ultracentrifuge (Optima XPN-100). Pellets containing Exos were washed in 0.9% NaCl and subjected to another round of centrifugation at 100,000 g for 70 min to further eliminate medium protein contaminants. The exosome pellets were then resuspended in 0.9% NaCl and stored at − 80 °C for subsequent analysis. Characterization of Exos was performed using transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA), and Western blot.

For TEM analysis, Exos were fixed with 2% PFA for 30 min after dilution with PBS, following a method previously described (Yang et al. 2019). The fixed Exos were suspended in PBS and fixed again with 2% PFA for an additional 30 min at room temperature. Subsequently, an 8 μL aliquot of the exosome suspension was loaded onto an EM grid that had been pretreated with ultraviolet light and allowed to incubate for 10 min. The Exos on the grid were then stained twice with 1% uranyl acetate (UA) solution, with each staining session lasting 6 min. Excess UA solution was removed by filter paper, and the grid was allowed to air dry. Finally, the Exos were visualized under a TEM (Hitachi Corp., Tokyo, Japan).

NTA was performed to detect the size of Exos. A small amount of the thawed Exos was added to 1 mL PBS. Their particle sizes were examined by NTA using a NanoSight NS500 device (Malvern Pananalytical, USA) in accordance with a previous study (Jiang et al. 2022).

The presence of exosomal characteristic surface marker proteins (CD81, CD9, and TSG101) were detected by Western blot.

Cell transfection and treatment

TRIM25 short hairpin RNA (sh-TRIM25), shRNA negative controls (sh-NC), pcDNA-TRIM25 overexpression vector, pcDNA-TREM1 overexpression vector, and empty pcDNA vector used in the present study were obtained from Santa Cruz Biotechnology (CA, USA). The BMDMs (1 × 106 cells/well) were inoculated in six-well plates. Transfection was performed using Lipofectamine 3000 (Thermo Fisher) according to the manufacturer’s instructions after the cell confluence reached about 80%. The cells were transfected for 48 h. Finally, the expression of TRIM25 and TREM1 was analyzed by real-time quantitative polymerase chain reaction (RT-qPCR). After transfection, BMSCs-derived Exos (2 μg of Exos per 1 × 105 recipient cells) were added to the culture medium for 12 h in line with a previous study(Lu et al. 2020).

Animal studies

A total of 30 adult female BALB/c (~ 20 g B.W; 9 weeks old) mice purchased from Dossy Experimental Animals Co., LTD (Chengdu, China) were housed in cages with 24 ℃, a 12 h alternating light/dark cycle and free access to water and food.

After one-week adaptive feeding, the mice were randomly divided into five groups (n = 5 per group): sham, ovariectomized (OVX), OVX + Exo, OVX + Exo + lentivirus negative control (LV-NC), and OVX + Exo + TRIM25 overexpression lentivirus (LV)-TRIM25. LV-NC and LV-TRIM25 (Santa Cruz Biotechnology) were injected into tail vein of mice after one week of model establishment. Next, the BMSC-Exos suspension (20 mg of Exos/mouse) was injected twice per week by intra-femoral injection. The establishment of OVX model was performed according the published procedure (Yang et al. 2019). Briefly, the mice were anaesthetized with pentobarbital sodium (30 mg/kg, Sigma), and then two bilateral incision (10 mm diameter) was made on lateral lumbar skin. The bilateral ovaries of the mice were cautiously removed by exposing the muscles and retroperitoneum by blunt dissection. The animals in the sham group received the same procedure without the removal of bilateral ovaries. The tissue was then repositioned and sutured. The mice were injected with 40,000 IU/mL penicillin at 1 mL/kg for 3 days. 2 months after OVX model establishment, the femur was obtained to confirm the occurrence of osteoporosis using micro-computed tomography (micro-CT) analysis.

micro-CT

Bone microarchitecture analysis of trabecular bone was performed using a micro-CT system (mCT-80, Scanco Medical, Brüttisellen, Switzerland), as previously described (Sun et al. 2022). The imaging parameters were set as follows: voxel size of 9 μm, voltage of 55 kV, and current of 70 mA. Following the scan, the region of interest (ROI) was selected between 0.3 to 0.6 mm from the highest point on the distal femur growth plate.

Subsequently, 3D images were analyzed to assess various bone parameters, including bone volume/tissue volume (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp).

Isolation and quantification of RNAs

Firstly, the commercial FastPure Cell/Tissue total RNA isolation kit V2 (Vazyme Biotechnology Co., LTD, Nanjing, China) was used to extract total RNA from cells. Then, the extracted RNA was reverse transcribed into cDNA using the Hifair® V one-step RT-gDNA digestion SuperMix for qPCR kit (Yeason Biotechnology, Shanghai, China), and the qPCR amplification experiment was performed using the Hieff® qPCR SYBR Green Master Mix kit (Yeason) with the reaction conditions: 95 °C for 5 min, 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 20 s and a melt curve stage. The gene expression was calculated by the 2−ΔΔCT method. Primers used in this study were synthesized by Geenseed Biotechnology Co., LTD (Guangzhou, China) and listed as follows: inducible nitric oxide synthase (iNOS), forward, 5′—CCAGCTAGCCAAAGTCACCAT—3′ and reverse, 5′—GTCTCGGAGCCATACAGGATT-3′; tumor necrosis factor-α (TNF-α), forward, 5′—GAGCAAGCCCTGGTATG—3′ and reverse, 5′—CGGGCCGATGAGATGATCTCTCG—3′; interleukin (IL)—6, forward, 5′—TGCAATAACCCCTGACC—3′ and reverse, 5′—ATTTGCCGAAGCCCG—3′; mannose receptor C-type 1 (MRC1) (CD206), forward, 5′—TGATACCTGCGACAGTAAACGA—3′ and reverse, 5′—CTTGCAGTATGTCTCCGCTTC-3′; IL-10, forward, 5′-GCCAAGCCTTGTCTGAGATGATCC-3′ and reverse, 5′—AATCGATGACAGCGCCGTAGC—3′; arginase 1 (Arg1), forward, 5′—GTGGAAACTTGCATGGACAAC-3′ and reverse, 5′—AATCCTGGCACATCGGGAATC-3′; tripartite motif (TRIM) 16, forward, 5′—GTCCTGTCTAACCTGCATGGT-3′ and reverse, 5′—GGCAGTATCGCCAGTTGTG—3′; TRIM21, forward, 5′-TCAGCAGCACGCTTGACAAT-3′ and reverse, 5′—GGCCACACTCGATGCTCAC—3′; TRIM25, forward, 5′—AATCGGCTGCGGGAATTTTTC—3′ and reverse, 5′-TCTCACATCATCCAGTGCTCT—3′; TRIM38, forward, 5′—GAGCCTGATGACGAACCCAG-3′ and reverse, 5′—TCTTGATCCGTCTCTTTGAGGG—3′; TRIM62, forward, 5′—CGAGCAGCATCAGGTCACC—3′ and reverse, 5′—CCAGTTGTCGCTTGAGCAG-3′; triggering receptor expressed on myeloid cell 1 (TREM1), forward, 5′—GAACTCCGAGCTGCAACTAAA-3′ and reverse, 5′-TCTAGCGTGTAGTCACATTTCAC—3′; glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5′—GACTCATGACCACAGTCCATGC—3′ and reverse, 5′—AGAGGCAGGGATGATGTTCTG—3′.

Western blot

Cells were lysed with RIPA lysis buffer for 30 min until complete lysis occurred. The lysate was then homogenized at 4 °C for 30 min and centrifuged at 12,000 rpm for 20 min at 4 °C. The resulting supernatant was carefully collected and stored at − 80 °C until use. Protein concentration was determined using the Bradford assay (Sigma). Subsequently, 50 μg of protein was separated by 10% SDS-PAGE (Thermo Fisher). Prior to use, the PVDF membrane was briefly soaked in pure methanol (Beyotime) for 5 s and then used for protein transfer. To minimize non-specific binding, the membrane was blocked with 5% BSA at 37 °C for 1 h. Following blocking, the membrane was incubated with primary antibodies (Abcam) overnight at 4 °C. After washing the membrane three times (10 min each) with Tris-buffered saline Tween (TBST, Beyotime), it was incubated with secondary antibodies (Abcam) at room temperature for 2 h. Finally, protein signals were detected using an enhanced chemiluminescence solution (Yeason).

Hematoxylin–eosin (H and E) staining

Femur tissues isolated from mice were first fixed in 4% PFA for 24 h, followed by decalcification in 15% ethylenediaminetetraacetic acid (EDTA, Yeason) for 21 days. After decalcification, the tissues were embedded in paraffin (Aladdin Biochemical Technology Co., LTD, Shanghai, China). Paraffin-embedded tissues were then sectioned serially into 4 μm thick sections. To prepare for staining, the sections were dewaxed in xylene (Sigma) and rehydrated through a series of ethanol gradients (95%, 90%, 80%, and 70%). For staining, the tissue sections were immersed in hematoxylin (Sigma) for 5 min, rinsed in running water, differentiated in 1% ethanol for 30 s, blueing in 0.6% ammonia water until the desired hue was achieved, and washed again in running water. Subsequently, the sections were stained with eosin (Sigma) for 3 min. Finally, after dehydration, the sections were mounted with neutral balsam mounting medium (Sangon Biotechnology, Shanghai, China), and images were acquired using a biopathology microscope (BX45-DP72, Olympus, Japan).

Co-immunoprecipitation (Co-IP) assay

The interaction between TRIM25 and TREM1 was assessed using the Co-IP assay following methods described previously (Luo et al. 2023). Cells were lysed on ice in RIPA buffer supplemented with a protease inhibitor (aprotinin, Yeason) for 20 min, followed by centrifugation at 12,000 g for 10 min at 4 °C. The resulting supernatant was collected, and 20 μL was reserved as the input sample, to which 2 × SDS sample buffer was added and boiled for 5 min. The remaining cell lysates were incubated overnight at 4 °C with specific antibodies, followed by the addition of protein A/G beads (Santa) and further incubation for 2 h. Subsequently, the beads were washed five times with cell lysis buffer, and the bound proteins were eluted using 2 × SDS sample buffer and boiled at 100 °C for 5 min. The eluates were then subjected to Western blot analysis.

Ubiquitination assay

IP assay combined with Western blot were used to access the ubiquitination level of TREM1 in HEK-293T cells. Briefly, the HEK-293T cell lysates were obtained and immunoprecipitated with anti-TREM1 antibody and protein A/G agarose (Santa), followed by Western blot analysis with the primary antibody against ubiquitin (PTM Biotechnology Co., LTD, Hangzhou, China).

Protein stability assessment

Protein stability assessment was performed to verify the protein stability of TREM1 after TRIM25 overexpression in HEK-293T cells. The cells were treated with cycloheximide (CHX, 100 μg/mL, Abcam), and the protein level of TREM1 at different time points (0, 2, 4, and 8 h) was detected.

Statistical analysis

SPSS 21.0 software was used to analyze data. Data are expressed as mean ± standard deviation (SD). Student’s t-test was used for comparison between the two groups. One-way analysis of variance (ANOVA) was used for comparison among groups. Statistical analyses were performed using GraphPad Prism software (v8.0.1, GraphPad Software Inc., San Diego, CA, USA). p < 0.05 indicates that the difference is statistically significant.