Chemicals and reagents

Antibodies against MDM2 and MDM4 were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). A polyclonal antibody for YPEL3 was obtained from Boster Bio (Pleasanton, CA, USA). RPMI 1640 medium and fetal bovine serum (FBS) were purchased from HyClone (Logan, UT, USA). Doxorubicin was obtained from Selleck Chemicals (Houston, TX, USA). The enhanced chemiluminescence (ECL) kit and bicinchoninic acid (BCA) protein assay kit were purchased from Thermo Fisher Scientific (Waltham, MA, USA). QGreenBlue 2X qPCR Master Mix was obtained from Cell Safe (Yongin, Korea), and D-Plus™ CCK cell viability assay kit was purchased from Dongin biotech (Seoul, Korea). All the chemicals and reagents used in the experiments were of the highest commercially available quality.

Cell culture

Human breast cancer MCF-7 cells were purchased from Korea Cell Line Bank (Korea). The cells were cultured in RPMI 1640 medium supplemented with 10% (v/v) heat-inactivated FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in a humidified atmosphere of 5% CO2.

Transient transfection of miRNA

MiRNA mimics were obtained from BIONEER (Daejeon, Korea), and the sequences were as follows: Hsa-mir-34a (UGUUGGUCGAUUCUGUGACGGGU), Hsa-mir-605-5p (UCCUCUUCCGUGGUACCCUAAAU). The cells were transfected with 80 nM miRNA mimics using the Neon™ transfection system (Invitrogen, Carlsbad, CA, USA) and cultured in antibiotic-free RPMI medium with 10% FBS for 48 h.

RNA isolation, reverse transcription, and RT-PCR

After transfection, mRNAs and miRNAs were extracted using the Hybrid-\(}^}\) miRNA kit (GeneALL, Seoul, Korea). Total RNA (1000 ng) was transcribed at 37℃ for 1 h in a 25-μl reaction volume containing RNase buffer, 10 mM dNTPs, RNase inhibitor, M-MLV reverse transcriptase, and 100 pmol of oligo-dT primers. The cDNA products were amplified using the Rotor-Gene SYB \(}^\) PCR kit (Qiagen, Hilden, Germany). Each reaction contained 10 μl of 2 × SYB \(}^\) Green PCR Master Mix, 2 μl of each oligonucleotide primer, and 2 μl of cDNA in a final volume of 20 μl. The amplification conditions were as follows: one cycle of 95 °C for 2 min, followed by 35 cycles of denaturation at 95 °C for 10 s, annealing at 58 °C for 15 s, and extension at 72 °C for 30 s. MiRNA (400 ng) was transcribed at 37 °C for 1 h in a 20-μl reaction volume containing 5 × miScript HiSpec Buffer, 10 × miScript Nucleics Mix, and miScript Reverse Transcriptase Mix (Qiagen, Seoul, Korea). The cDNA products were amplified using target-specific miScript Primer Assays and the miScript SYBR Green PCR kit with a final volume of 20 μl. The amplification conditions were as follows: one cycle of 95 °C for 15 min, followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at each Tm 52–62 °C for 30 s, and extension at 70 °C for 30 s. The primer sequences used in this experiment are listed in Table 1.

Table 1 Primer sequences used in real-time qPCRWestern blotting

Cells were harvested and solubilized in ice-cold lysis buffer containing 50 mM Tris–HCl (pH 8.0), 0.1% sodium dodecyl sulfate (SDS), 1% Triton X-100, 0.5% sodium deoxycholate, 2 mM EDTA, 10 mM NaF, 150 mM NaCl, and 1 mM phenylmethylsulfonyl fluoride. The protein concentration was measured using BCA protein assay reagents. The extracted proteins (40 μg) were heated at 99 °C for 5 min, loaded onto 10%–15% SDS–polyacrylamide gel, and then electrochemically transferred onto polyvinylidene difluoride membranes. After being transferred, nonspecific binding to membranes was blocked with skimmed milk (5%) in Tris-buffered saline containing 0.1% Tween-20 (TBS-T) for 1 h at 4 °C. After overnight incubation with specific primary antibodies (1:1000 dilution), the membranes were washed thrice with TBS-T for 10 min each. Subsequently, the membranes were incubated overnight with secondary antibodies (1:5000 dilution) at 4 °C. Protein bands were visualized using the ECL method. The band intensity on the western blots was quantified and analyzed using ChemiDoc XRS (Bio-Rad, Hercules, CA, USA) and normalized to that of β-actin.

Confocal microscopy

The cells after transfection of control or mimics for miR-34a and miR-605-5p were seeded on poly-D-lysine-coated coverslips. After incubation at 48 h, the cells were fixed with 4% (w/v) formaldehyde in PBS for 30 min at 25 °C. After washing with PBS, the cells were blocked for 40 min in PBS containing 5% goat serum and 0.2% Triton X-100. After overnight incubation with a 1:200 dilution of the primary antibodies, the cells were washed and stained with a 1:200 dilution of the secondary antibodies. After an additional wash process, the coverslips were mounted onto glass slides with 3 μL of UltraCruz™ Mounting Medium containing 4′,6-diamidino-2-phenylindole. Fluorescence signals were analyzed using an LSM800 Confocal Laser Scanning Microscope (Carl Zeiss, Jena, Germany).

Cell viability assay

MCF-7 cells (5 × 103 cells/well) were plated in 96-well microplates and incubated for 96 h at 37 °C. Before seeding, the cells were transfected with miR-34a or miR-605-5p mimics (80 nM). After incubation, the cells were treated with 10 μL of CCK solution (Dongin biotech) and incubated for 1 h at 37 °C. The produced formazan dyes were quantified by measuring the absorbance at 450 nm using a Tecan Sunrise™ microplate reader (Männedorf, Switzerland). All experiments were independently performed in triplicate.

Senescence-associated β-galactosidase assay

MCF-7 cells (1 × 106 cells/well) were seeded in 6-well plates after transfection with miRNA mimics. The cells were stained at 37 °C overnight with a staining solution in SA-β-galactosidase (gal) staining kit (Cell Signaling Technology, USA) following the manufacturer’s instructions.

Analysis of MitoPotential function

Transfected cells were seeded at a density of 1 × 105 cells. After harvesting with 0.1% trypsin–EDTA, the cell pellet was resuspended in the assay buffer of the MitoPotential kit (Millipore, Germany). The cells were stained with MitoPotential working solution for 20 min. After staining, the cells were incubated with 7-aminoactinomycin D for 5 min. MitoPotential function was measured using MUSE® Cell Analyzer (Millipore) following the manufacturer’s instructions.

Bioinformatics analysis

A TNM plot analysis (https://tnmplot.com/analysis/) was performed to elucidate the expression of MDM4, MDM2, YAP1, and YPEL3 in breast cancer. Specific miRNAs targeting MDM4, MDM2, or YAP1 were found using the bioinformatic databases as candidates for further studies; miRTarBase (http://mirtarbase.cuhk.edu.cn/php/index.php), TargetScan (http://www.targetscan.org), and miRDB (http://www.mirdb.org).

Statistical analysis

Statistical analyses were conducted using one-way analysis of variance, followed by the Dunnett’s multiple comparison and t tests, in Prism version 10.0.0 (GraphPad Software Inc., San Diego, CA, USA). Differences were considered statistically significant at p < 0.05.