Reagents

Antibodies targeting Matrix metallopeptidase 13 (MMP13),collagen type II(Collagen II), (Interleukin—1β)IL-Iβ, PI3K, and p-PI3K were purchased from ImmunoWay (Texas, USA); antibodies targeting Akt, p-Akt,COX-2 and GAPDH were purchased from Hua'an (Hangzhou, China); and trypsin, radioimmunoprecipitation assay (RIPA) buffer, phenylmethanesulfonyl fluoride (PMSF), a BCA kit, 5 × SDS‒PAGE sample loading buffer, BeyoECL Plus and penicillin–streptomycin were purchased from Beyotime (Shanghai, China). Collagenase II was obtained from Sigma (St. Louis, MO, USA). DMEM/F12 was purchased from HyClone (South Logan, UT, USA). Foetal bovine serum was obtained from Vicente. TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, USA). 5 × HiScript II qRT SuperMix II was purchased from Vazyme (Nanjing, China). Goat anti-rabbit IgG and goat anti-mouse IgG were purchased from ZSGB-BIO (Beijing, China). Recombinant human IL-1β was obtained from PeproTech (Rocky Mount, NJ, USA). Cucurbitacin E and SC79 (Akt activator) were obtained from MedChemExpress (Shanghai, China). A Cell Counting Kit-8 was purchased from 7Sea Biotechnology (Shanghai, China). All gene primers were synthesized by Jereh Biotechnology (Shanghai, China). Safranin O staining solution was purchased from Solarbio (Beijing, China). The reagents for saffron staining, safranin-O/Fast Green staining, Alcian blue staining and HE staining were all obtained from Servicebio (Beijing, China). Polyvinylidene fluoride (PVDF) membranes and dimethyl sulfoxide (DMSO) were purchased from Thermo Fisher Scientific (Shanghai, China).

Cell culture and animal model

Human cartilage was obtained from OA patients who underwent total knee arthroplasty (TKA) at the First Affiliated Hospital of Anhui Medical University. This study was approved by the clinical Ethics Committee of the First Affiliated Hospital of Anhui Medical University (Reference number: PJ2023-12-63). The cartilage pieces were minced in a sterile environment, with 0.25% trypsin added to a 2 × volume of minced cartilage, followed by digestion in a 37 °C incubator for 30 min.After discarding the trypsin, the cartilage was soaked with an equal amount of medium containing 0.1% collagenase II for 24 h. Then, the digested cartilage was centrifuged at 500 r/min for 5 min. We obtained the supernatant from the digested tissues after low-speed centrifugation (500 r/min × 5 min), and the supernatant was centrifuged again (1200 r/min × 5 min) to obtain the chondrocyte precipitate. Isolated chondrocytes were resuspended in DMEM/F-12 (an antibiotic mixture containing 10% FBS, 1% L-glutamine, and 1% penicillin and streptomycin) and incubated with 5% CO2 at 37 °C. The experimental mice were C57BL/6 mice obtained from Beijing Spelford Biotechnology Co., Ltd. (purchase batch number: No.110324221100930336). The C57BL/6 mice were 8-week-old male mice. After 1 week of adaptation in specific pathogen-free (SPF)-grade housing in the laboratory, the C57BL/6 mice were randomly divided into three groups (n = 6–8 mice/group): the sham group, DMM group and Cucurbitacin E intervention group. One week later, mice in the three groups were anaesthetized. The mice in the DMM group and Cucurbitacin E intervention group underwent DMM surgery, in which an incision was made in the skin of the knee joint and the medial collateral ligament of the knee joint was cut, while the mice in the sham group underwent sham surgery without cutting of the medial collateral ligament of the knee joint. One month later, Cucurbitacin E dissolved in solvent (0.5 mg/kg) was injected into the joint cavity of each mouse in the Cucurbitacin E intervention group twice a week for 3 months [23,24,25]. The mice in the other two groups were injected with equal amounts of normal saline in the joint cavity. We assessed the knee joint condition in mice using the OARSI score, a standard used to assess the severity of osteoarthritis. Developed jointly by the European Osteoarthritis Society and the U.S. The Food and Drug Administration, the OARSI is one of the most commonly used clinical criteria for evaluating osteoarthritis. The schematic of the animal experiment is shown in Fig. 5A. This study was approved by the Ethics Committee of the Animal Experimental Center of Anhui Medical University (Reference number: LLSC20231221).

Cell viability assay (CCK-8 assay)

The cytotoxicity of Cucurbitacin E in chondrocytes was evaluated by a Cell Counting Kit 8 (CCK-8) assay. Chondrocytes were spread evenly in 96-well plates (5000 cells/well), incubated in a warm oven for 24 h, and then treated with different concentrations of Cucurbitacin E (1, 5, 10, 20, 40, and 80 nM) for 24 h. Subsequently, 10 μl of CCK-8 solution was added to each well, and the plates were incubated for 2 h at 37 °C. The absorbance at 450 nm was measured.

Chondrocyte toluidine blue staining and safranin O staining

Chondrocytes were seeded in 12-well plates and incubated for 48 h. The chondrocytes were then washed 3 times with PBS solution and fixed with 4% paraformaldehyde solution for 10 min. Paraformaldehyde was washed away with PBS, and the chondrocytes were observed directly under the electron microscope for imaging; after paraformaldehyde fixation, toluidine blue staining was performed by treatment with 1% toluidine blue solution for 30 min at room temperature followed by the washing of excess toluidine blue dye from the surface with PBS, and the chondrocytes were then observed under the microscope and photographed. Chondrocytes were inoculated in 24-well plates. At confluence, chondrocytes were treated with Cucurbitacin E (10 nM) and IL-1β (10 ng/mL), and the medium was changed every 24 h. At the indicated time points, the chondrocytes were washed with PBS and fixed with 4% paraformaldehyde for 30 min. The chondrocytes were then incubated with safranin O cartilage staining solution (Solabio, China). After incubation at room temperature for 30 min, the staining solution was removed, and the chondrocytes were washed with PBS. Staining was photographed.

Drug preparation and incubation

Cucurbitacin E in powder form was dissolved in DMSO, and different stock solutions used to prepare the working solutions of the desired drug concentrations (1 mM, 5 mM, 10 mM) were prepared. The IL-1β concentration was adjusted to 10 µg/ml with exclusive diluent. Chondrocytes were seeded in six-well plates and incubated for 48 h. The premade stock solutions of different concentrations of Cucurbitacin E were diluted with DMEM/F12 to the desired concentrations (1 nM, 5 nM, 10 nM), and chondrocytes then were incubated with various concentrations of Cucurbitacin E. After a 2 h pretreatment, IL-1β was added at a diluted concentration of 10 ng/ml to mimic the induction of osteoarthritic properties in cells in vitro, and the cells were then incubated for 24 h. The chondrocytes were incubated with various concentrations of Cucurbitacin E. SC79 was dissolved in DMSO, and the concentration of DMSO in all experimental groups was lower than 0.1%. The chondrocytes in the treatment group were pretreated with SC79 (4 µg/ml) for 1 h to activate the Akt pathway [26].

Western blotting

The expression of target proteins was measured by immunoblotting. For immunoblotting, Chondrocytes were lysed with a mixture of radioimmunoprecipitation assay (RIPA) buffer and phenylmethanesulfonyl fluoride (PMSF) (100:1), and the protein concentrations were measured using a BCA kit after purification of total protein by high-speed cryogenic centrifugation (12,000 g/min × 15 min, 4 °C). Then, we mixed the supernatant with 5 × SDS‒PAGE sample loading buffer. Equal amounts of protein were separated by SDS‒PAGE using a 10% or 12% polyacrylamide gel. The proteins were then transferred onto PVDF membranes, which were placed in Tris-buffered saline with Tween 20 (TBST)-5% skim milk for 2 h at room temperature. After washing, the membranes were incubated with the corresponding antibody specific for IL-1β (1:1000), COX-2 (1:1000), MMP-13 (1:1000), Collagen II (1:1000), PI3K (1:1000), p-PI3K (1:1000), Akt (1:1000), p-Akt (1:1000), or GAPDH (1:1000) at 4 °C overnight. The membranes were then washed at room temperature and incubated in TBST-5% skim milk containing goat anti-rabbit IgG or goat anti-mouse IgG for 2 h. The membranes were washed again with TBST, and signals were detected using BeyoECL Plus.

RT‒qPCR

Chondrocytes were pretreated with Cucurbitacin E (1, 5, 10 nM) for 2 h and stimulated with or without IL-1β (10 ng/ml) for 24 h, and total RNA was then extracted. TRIzol reagent was used according to the manufacturer’s instructions, and cDNA was reverse transcribed according to the mRNA concentration. The Agilent Mx3000P system was used for quantitative real-time PCR under the following thermal cycling conditions: predenaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s, denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, and denaturation at 95 °C for 15 s. The primers were designed with the help of the NCBI Primer-BLAST tool. The primer sequences are listed as follows: MMP13(human): (Forward) 5′CCTTGATGCCATTACCAGTCTCC3′, (Reverse) 5′AAACAGCTCCGCATCAACCTGC3′; Collagen II (human): (Forward) 5′CCTGGCAAAGATGGTGAGACAG3′, (Reverse) 5′CCTGGTTTTCCACCTTCACCTG3′; GAPDH (human): (Forward) 5′ACCCAGAAGACTGTGGATGG3′, (Reverse) 5′TTCAGCTCAGGGATGACCTT3′.

Fluorescence microscopy

Chondrocytes were seeded in 12-well plates with coverslips for culture, cotreated with IL-1β (10 ng/ml) or IL-1β in combination with 10 nM Cucurbitacin E, and incubated with serum-free medium for 24 h. Next, the coverslips were removed. After being washed three times with phosphate-buffered saline (PBS), the chondrocytes were fixed with 4% paraformaldehyde for 30 min at room temperature, washed three times with PBS, and permeabilized with 0.5% Triton X-100 for 20 min at room temperature. Then, the cells were blocked with 5% BSA at 37 °C, washed with PBS and incubated with primary antibodies against MMP13 (1:200) and Collagen II (1:200) for 24 h at 4 °C. Subsequently, the cells were washed three times with PBS and incubated with goat anti-rabbit IgG for 2 h at room temperature. Then, nuclei were labelled with 4',6-diamidino-2-phenylindole (DAPI) for 10 min. The slides were blocked after washing with PBS and imaged with a fluorescence microscope.

Bioinformatics analysis and screening

First, the NCBI website (https://www.ncbi.nlm.nih.gov/) was used to download osteoarthritis and related normal cartilage gene expression data from the GSE114007 and GSE117999 datasets in the GEO database. The data in the GSE114007 dataset [27] are based on gene sequencing with the GPL11154 platform and constitute the gene expression data of 18 normal cartilage tissues and 20 OA cartilage tissues. The data in the GSE117999 dataset are based on gene sequencing with the GPL20844 platform and constitute the gene expression data of 10 normal cartilage tissues and 10 OA cartilage tissues. Then, a Perl script was used to combine the GSE114007 and GSE117999 datasets. To reduce batch effects between the two sets of data and errors in screening differential genes, the normalizeBetweenArrays function of R software was used to normalize the combined data. At the same time, the R software limma package was used for analysis of differentially expressed genes in normal samples and OA samples. In this analysis, |logFC|> 0.585 was set as the screening criterion for differences in expression, and p < 0.05 was considered to indicate a significant difference. Finally, KEGG pathway enrichment analysis of the significantly differentially expressed genes was performed by the "ClusterProfiler" package in R, and p < 0.05 was set as the criterion for significance (R version R4.1.2).

Cellular thermal shift assay

CETSA is an intracellular assay to measure the binding efficiency of a drug to a target protein and is based on the principle that the target protein generally becomes stable when bound to a drug molecule. That is, with increasing temperature, the protein is degraded, and when the protein binds to the drug, the amount of undegraded protein increases at the same temperature [28, 29]. In as accordance with the cell culture method described above, human primary chondrocytes were cultured in a large 10 cm dish, and RIPA buffer containing a protease inhibitor was added for lysis on ice for 20 min; the lysates were then transferred to 1.5 mL EP tubes and centrifuged at 4 °C for 15 min at 12,000 r/min, and each tube was then thoroughly shaken and divided into 2 tubes. Cucurbitacin E at the working concentration was added to 1 tube, and an equal volume of DMSO solution was added to the other tube; the tubes were shaken well and incubated at room temperature for 2 h. Then, the two tubes of solution were evenly divided into 5 small EP tubes, and each tube was incubated at a different temperature gradient set for 5 min. Finally, the supernatant was centrifuged, mixed with SDS solution, and heated in a metal water bath at 95 °C for 10 min. Western blot analysis was performed after these steps were completed.

Molecular docking model and molecular dynamics simulation

The 3D molecular structure of the compound Cucurbitacin E (ID:5281319) was downloaded from the PubChem website (https://pubchem.ncbi.nlm.nih.gov/) in sdf format. Then, the Cucurbitacin E structure was optimized and assigned a partial charge under the Amber10-EHT force field (MOE2022). Then, 81 poses of the optimized structure were generated using the conformation search module of MOE for molecular docking. The three-dimensional structure was retrieved from the Protein Data Bank (https://www.rcsb.org/structure/3LJ3). The crystal model (3LJ3) was protonated and optimized by the MOE plugin “QuickPrep”. In the docking process, the coarse-grained model and the side chains of the contact residues were optimized, up to 1000 conformations were retained using the London δ scoring function and were then docked with IFD (induced fit docking) and optimized using energy minimization, and the binding energies were calculated by the GBVI/WSA scoring function. Finally, the top 100 docking poses were retained and clustered, and the best pose was selected as the final pose.

The complex structures were optimized using the Protein Preparation Wizard [30] panel (Schrödinger 2021) by correcting the bond order, adding hydrogen atoms, distributing charges, and predicting protonation states (pH 7.0). The OPLS4 force field was used for constrained energy optimization to eliminate atomic conflicts in the structure with the RMSD of heavy atoms converging to 0.3 Å, and the side chain position was optimized to obtain a reasonable side chain structure; the resulting structures were saved as Protein-F6724-4856.pdb (Cpd1), Protein-STOCK1N-88112.pdb (Cpd2), and Protein-STOCK1N-90146.pdb (Cpd3). We employed the Desmond [31] program for molecular dynamics simulation based on the OPLS4 force field. The complexes were solvated in a cubic box with the TIP3P water models, and NaCl (0.15 mol/L) was added to neutralize the system (Additional file 1: Fig. S1A). The system was subjected to minimization and equilibration for 100 ps (10,000 steps with Brownian motion simulation) to adequately equilibrate complexes and solvent molecules. Harmonic position restraints were applied on the backbone of the protein with a force constant of 1 kcal mol−1 Å−2 and a time step of 2 fs. An MD simulation with equilibration for 100 ns was performed with the NPT ensemble at 300 K with a Nose–Hoover chain thermostat (relaxation time 100 ps) and at 1 atm with an isotropic Martyna–Tobias–Klein barostat (relaxation time 100 ps). The time step was set to 2.0 fs. Short-range electrostatic interactions were calculated with a cut-off of 9.0 Å, and long-range electrostatic interactions were calculated with the PME method. The trajectories were saved every 5 ps for further analyses.

Immunohistochemical analysis and tissue staining

Specimens were fixed with 4% paraformaldehyde for 24 h and decalcified with 10% ethylenediaminetetraacetic acid for 4 weeks. The tissues were embedded in paraffin and sliced perpendicular to the articular cartilage surface into 5-μm-thick sections, which were soaked in three different dye solutions for staining: saffron O/solid green, HE, and Alcian blue [32]. The extent of cartilage degeneration was assessed using the Osteoarthritis Research Society International (OARSI) cartilage histopathological assessment system as follows (six OA grades): 0 = intact surface; 1 = intact cartilage; 2 = discontinuous surface; 3 = vertical fissures; 4 = erosion; 5 = denudation; and 6 = deformation.

For immunohistochemical staining, tissue sections were dewaxed in xylene solutions, and 3% hydrogen peroxide was then used to quench endogenous peroxidase activity. The sections were incubated with 0.4% pepsin (Sigma‒Aldrich) in 1 mM hydrochloric acid at 37 °C for 1 h for antigen repair. The blocking solution was a PBS solution containing 5% BSA. After incubation with blocking solution at 37 °C for 30 min, the sections were incubated with primary antibodies against MMP13 (1:200),Collagen II (1:200), IL-1β (1:100), and COX-2 (1:100). Subsequently, counterstaining was performed with haematoxylin. Images of the selected areas were acquired using an optical microscope, and expression was quantified from the images based on histological staining.

Statistical analysis

All data are expressed as the means ± standard deviations. One-way analysis of variance (ANOVA) with SPSS V.23.0 (SPSS Inc., Chicago, USA) was used to analyse differences among groups. P < 0.05 was considered to indicate a statistically significant difference.