Cell line

The hiPSC line was derived from human umbilical cord blood CD34+ cells according to published protocols [23] and established in the Lonza Walkersville facility (Lonza Laboratories, Walkersville, MD, USA). The hiPSCs and gene-engineered hiPSCs were maintained in AK03N medium (Ajinomoto Pharma, Tokyo, Japan) on dishes coated with iMatrix511MG (Matrixome, Osaka, Japan) in a 37℃, 5% CO2 humidified incubator.

Generation of HLA class Ia/II DKO hiPSCs

HLA-A, HLA-B, HLA-C, and RFXANK genes were inactivated using Cas9 with two-piece guide RNA (gRNA). To prepare two-piece gRNAs, the synthesized crRNA (Thermo Fisher Scientific, Waltham, MA, A35512) was mixed with tracrRNA (Thermo Fisher Scientific, A35512). The sequences of the target region used in this study are listed in Table 1. The two-piece gRNA was mixed with HiFi Cas9 nuclease protein (Integrated DNA Technologies, Coralville, IA) in a ratio of 1:1 to produce a Cas9 ribonucleoprotein (RNP) complex. One hundred picomoles of Cas9 RNP complex were electroporated into 1.0 × 106 hiPSCs in Neon Buffer R using the Neon Transfection System (Thermo Fisher Scientific) with Preset-Program No. 12 (1200 V, 40 ms, 1 pulse). Each Cas9 RNP complex of HLA-A, -B, and -C genes was sequentially electroporated at five-day intervals to obtain HLA class Ia KO clones. After the final electroporation step, to establish clones, the cells were plated in 96-well plates as single cells per well. Twelve days after plating, the cells of each clone were transferred to wells of a 24-well plate and wells of a 96-well plate. The cells in the 96-well plates were used for screening. The cells in the 24-well plates were seeded to 9 cm dishes for further expansion and cryopreserved.

Table 1 The sequences of the gRNAs used in this study

To identify HLA class Ia KO clones, the clones were treated with 25 ng/mL IFN-γ (R&D Systems, Minneapolis, MN) for 3 days and stained with Alexa Fluor 488-labeled anti-HLA class I antibody (clone W6/32, R&D Systems, FAB7098G) and those with drastically decreased expression of HLA class Ia molecules were selected for further screening. Next, the clones were tested for the presence of altered sequences from the cleavage site using the in vitro Cas9 cleavage assay [24]. Briefly, the cells were lysed with Lysis Buffer for PCR (Takara Bio, Kusatsu, Japan) to obtain crude genomic DNA, and the target sites were amplified by PCR using PrimeSTAR GXL Premix (Takara Bio) with the primer sets listed in Table 2. Next, 3 μL of PCR product and 1.6 pmol Cas9 RNP complexes for each gene were mixed and allowed to cleave the PCR product at 37 °C for 60 min. Agarose gel electrophoresis was performed to analyze the length of the PCR product. The clone with uncut PCR product was selected as a homozygous mutant. Finally, HLA class Ia clones with frameshift mutations were selected by analyzing the DNA sequences of the target sites. To confirm the expression by flow cytometry, HLA class Ia KO clones were treated with 25 ng/mL IFN-γ for 3 days and stained with APC-labeled anti-HLA-A/B/C antibody (clone G46-2.6, BD Pharmingen, 562,006).

Table 2 The sequences of the primer sets used in this study

To obtain HLA class Ia/II DKO clones, HLA class Ia KO clone was electroporated with Cas9 RNP targeting the RFXANK gene under the same electroporation conditions described above. The electroporated cells were plated in 96-well plates as single cells per well to establish clones. Twelve days after plating, the cells of each clone were transferred to wells of 24-well plates and 96-well plates. The cells in the 96-well plates were used for screening. The cells in the 24-well plates were seeded to 9 cm dishes for further expansion and cryopreserved. The clones were tested for the presence of altered sequences from the cleavage site using the in vitro Cas9 cleavage assay [24]. The target sites were amplified by PCR with the primer sets listed in Table 2. The clones with uncleaved PCR products only were selected as a homozygous mutant. Finally, RFXANK KO clones with frameshift mutations were selected by analyzing the DNA sequences of the target sites.

Plasmid construction

The piggyBac donor vector (pPB) was created by introducing piggyBac internal tandem repeats (ITRs) and the desired restriction sites into pHSG298 cloning vector (Takara Bio). To introduce gene expression cassettes between the piggyBac ITRs of pPB, the respective coding regions of human B2M (NM_004048.2), HLA-G (NM_002127.4), RapaCasp9 [21], and PDL1-P2A-PDL2 (NM_014143.3 and NM_025239.3) under the control of human EF1α promoter, the internal ribosome entry site (IRES) (NC_001479.1: 260..845)—puromycin resistance gene (human codon optimized sequence from pPUR plasmid; U07648.1: 432..1031) cassette flanked by loxP sequence (ATAACTTCGTATAGCATACATTATACGAAGTTAT), and human GH1 poly(A) (NC_000017.11: 63,917,308..63,916,826) were added. To create the PBase expression vector, human codon-optimized Trichoplusia ni PBase (J04364.2) (hPBase) under the control of the human EF1α promoter, IRES-hygromycin resistance gene (pTK-Hyg plasmid; U40398.1: 2577..1540), and human GH1 poly(A), were assembled into pHSG298 cloning vector. The fragment of the human EF1α promoter was amplified from pBApo-EF1α Pur plasmid (Takara Bio) by PCR. The other fragments were chemically synthesized by Thermo Fisher Scientific.

Generation of HyPSCs

To obtain HyPSCs, equimolar amounts of four pPB vectors (total 5 μg), and 5 μg hPBase expression vectors were electroporated into 1.0 × 106 HLA class Ia/II DKO cells under the same electroporation conditions described above. The electroporated cells were cultured in a complete AK03N medium (Ajinomoto) supplemented with puromycin and hygromycin (Thermo Fisher Scientific) for one day and then with puromycin for another 6 days to select the cells expressing all transgenes. The selected cells were dissociated into single cells and seeded into 96-well plates at single cell per well density and cultured for approximately 2 weeks. The candidate clones were expanded and finally cryopreserved. Protein expression of transgenes in gene-modified hiPSC clones was confirmed by flow cytometry for detection of the expression of B2M, HLA-G, PD-L1, and PD-L2 molecules. For the detection of the expression of B2M, HLA-G, PD-L1, and PD-L2 molecules, the cells were stained with APC-labeled anti-PD-L1 antibody (1:20; clone MIH1; Invitrogen, 17–5983-42), FITC-labeled anti-PD-L2 antibody (1:10; clone MIH18; Miltenyi Biotec, 130–098-528), PECy7-labeled anti-B2M antibody (1:20; clone 2M2; BioLegend, 316,318), and PE-labeled anti-HLAG antibody (1:100; clone MEM-G/9; Abcam, Cambridge, England, ab24384). The expression of RapaCasp9 in HyPSCs was assessed by western blotting using a Jess Automated Western Blot System (ProteinSimple, San Jose, CA). Cell lysates were extracted using phosphate buffered saline (PBS) supplemented with 0.5% SDS solution (NIPPON GENE, Toyama, Japan) and protease inhibitor cocktail (FUJIFILM Wako Pure Chemicals, Osaka, Japan). The cell lysates were loaded on the Jess/Wes Separation 12–230 kDa 8 × 25 Capillary Cartridges (ProteinSimple). Anti-FKBP12 antibody (Abcam, ab2918) and anti-β-actin antibody (Abcam, ab179467) were used for labeling specific proteins. The bound antibodies were visualized with the anti-rabbit Detection Module without dilution (ProteinSimple) and quantified by Compass for SW software (ProteinSimple). A complete image of the 25 capillaries is available in Fig. S4. The karyotype analysis was done by Sumika Chemical Analysis Service, Ltd. Tokyo, Japan.

Immunocytochemistry

The HyPSCs were seeded in a 24-well plate at a density of 4.5 × 103 cells per well and cultured for 6 days to allow colonies to form. For fixation, the cells were washed with PBS, then fixed in 4% paraformaldehyde (PFA) phosphate buffer solution (FUJIFILM Wako Pure Chemicals) for 15 min at room temperature, and washed two additional times in PBS. The permeabilization step involved treating the cells with a 0.1% Triton X-100 solution (BioVision Research, Mountain View, CA) in PBS for 20 min at room temperature. The cells were then blocked with Blocking One solution (Nacalai Tesque, Kyoto, Japan) for 60 min at room temperature and stained with Anti-NANOG Rabbit pAb (1:100; ReproCell, Japan, RCAB004P-F) and Anti-OCT-3/4 mouse mAb (1:200; clone C10, Santa Cruz Biotechnology, Santa Cruz, CA, SC-5279), which were diluted in Dako Real Antibody diluent (Agilent Technologies, Santa Clara, CA). Then, the cells were thoroughly washed three times with the Triton X-100 solution (BioVision) and reacted with Alexa Fluor 488 conjugated Donkey anti-Mouse IgG (1:500; Thermo Fisher Scientific, A21202), or Alexa Fluor 546 conjugated Donkey anti-Rabbit IgG (1:500; Thermo Fisher Scientific, A10040), depending on the host species of the primary antibody. The secondary antibodies were prepared in a solution containing 5 μg/mL 4’,6’-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) for nuclear staining. The cells underwent a similar washing process as above. Finally, an inverted fluorescence microscope ECLIPSE Ti (Nikon, Japan) equipped with 10 × and 20 × objectives and filters for DAPI, fluorescein isothiocyanate, and Cyanine 3 was used to visualize the cellular staining patterns.

Alkaline phosphatase staining

Alkaline phosphatase staining was done using a Vector Blue Alkaline Phosphatase Substrate Kit following the manufacturer’s protocol (Vector Laboratories, Burlingame, CA). In brief, 4.5 × 103 HyPSCs were seeded in a 24-well plate and cultured for 6 days. The cells were fixed with 4% PFA (FUJIFILM Wako Pure Chemicals) and stained with a Vector Blue Alkaline Phosphatase Substrate Kit (Vector Laboratories) according to the manufacturer’s instructions. After the staining reaction was stopped, the stained cells were observed under a bright field microscope (Olympus, Tokyo, Japan).

Cell viability assay

HyPSCs and wild type (WT) hiPSC cells were seeded in a 96-well plate at a density of 5.0 × 103 cells per well. The following day, the culture medium was replaced with a medium containing different concentrations (0.003 nM, 0.01 nM, 0.03 nM, 0.1 nM, 0.3 nM, or 1 nM) of rapamycin (Selleckchem, Munich, Germany). Cell viability was measured at 24 h post-rapamycin treatment using the CellTiter-Glo Luminescent Cell Viability Assay (Promega, Madison, WI), according to the manufacturer’s instructions. Luminescence in each well was measured with a SYNERGY H1 microplate reader (Agilent Technologies). Cell viability was calculated using the luminescence values obtained under the various rapamycin treatment conditions. The viability of untreated WT cells and HyPSCs was used as the reference value (set as 1), and the relative cell viability was calculated by dividing the luminescence value of rapamycin-treated cells by the reference value.

Tri-lineage differentiation

To generate embryoid bodies, HyPSCs (1.0 × 104 per well) were seeded in a PrimeSurface 96-well U-bottom plate (S-BIO, Tokyo, Japan) and cultured first in StemFit AK03N medium without Liquid C (Ajinomoto) supplemented with 10 μM Y-27632 for a day, and then in StemFit AK03N medium without Liquid C (Ajinomoto) for another 6 days. The obtained embryoid bodies were seeded at a density of 4 embryoid bodies per well in a gelatin-coated 24-well plate and cultured in DMEM (Nakalai Tesque, Kyoto, Japan) supplemented with 10% fetal bovine serum (FBS; CORNING, Corning, NY), 1 × MEM NEAA Solution (Thermo Fisher Scientific) and 1 × GlutaMAX (Thermo Fisher Scientific) for 21 days. The attached cells were washed with PBS, fixed in 4% PFA solution (Nakalai Tesque), permeabilized in 0.2% Triton X-100 (Merck, Darmstadt, Germany), and stained with anti-βIII tubulin antibody (1:500; rabbit polyclonal, Abcam, ab18207), anti-α-SMA antibody (1:10; clone 1A4, Agilent Technologies, IR611), and anti-SOX17 antibody (1:100; goat polyclonal, R&D Systems, AF1924), respectively. The stained cells were washed with PBS and incubated with the secondary antibodies anti-rabbit IgG antibody Alexa 488 (1:1000; Thermo Fisher Sciences, A21206), anti-mouse IgG antibody Alexa 488 (1:1000; Thermo Fisher Sciences, A21202), and anti-goat IgG antibody Alexa 488 (1:1000; Thermo Fisher Sciences, A11055), respectively. Hoechst33342 (Thermo Fisher Sciences) was used for nuclear staining. The fluorescent images of stained cells were captured with a BZ-X710 all-in-one fluorescence microscope (KEYENCE, Osaka, Japan).

Differentiation to HPCs

Induction of differentiation from hiPSCs into HPCs was performed according to the literature [25]. WT and gene-edited hiPSCs were seeded at a density of 3.0 × 103 cells per dish onto 60 mm dishes coated with iMatrix-511 (Matrixome) and cultured in AK03N (Ajinomoto) supplemented with 10 µM Y-27632 (FUJIFILM Wako Pure Chemical). The following day, the medium was replaced with AK03N (Ajinomoto) and cultured for 6 days. For mesoderm induction, the cells were replaced and cultured in Essential 8 (Thermo Fisher Scientific) supplemented with 80 ng/mL bone morphogenetic protein 4 (BMP4; FUJIFILM Wako Pure Chemical), 2 μM CHIR99021 (FUJIFILM Wako Pure Chemical), and 80 ng/mL vascular endothelial growth factor (VEGF165; FUJIFILM Wako Pure Chemical) for 2 days and in Essential 6 (Thermo Fisher Scientific) supplemented with 80 ng/mL VEGF165 (FUJIFILM Wako Pure Chemical), 50 ng/mL stem cell factor (SCF; FUJIFILM Wako Pure Chemical), and 2 μM SB431542 (FUJIFILM Wako Pure Chemical) for an additional 2 days. To induce HPC differentiation, the cells were replaced and cultured with StemPro-34 SFM (Thermo Fisher Scientific) supplemented with 50 ng/mL SCF (FUJIFILM Wako Pure Chemical) and 50 ng/mL FLT3L (PeproTech, Rocky Hill, NJ) for 10 days. Then, the floating cells that appeared were sequentially collected for another 8 days and the collected cells were cryopreserved. The expression of HPC-specific markers was measured with a MACSQuant Analyzer 10 Flow Cytometer (Miltenyi Biotec, Bergisch Gladbach, Germany) using anti-CD45 antibody (1:20; clone HI30; BD Pharmingen, 563,880) and anti-CD43 antibody (1:20; clone 1G10; BD Pharmingen, 555,475).

Differentiation to endothelial cells

The method for differentiation of HyPSCs into ECs was based on the literature [26, 27] with modifications. Briefly, 2.5 × 106 HyPSCs were seeded in iMatrix-511 (Matrixome) coated culture dishes containing StemFit AK03N (Ajinomoto) supplemented with 10 µM Y-27632 (FUJIFILM Wako Pure Chemical). The following day, the medium was replaced with a mesoderm induction medium composed of DMEM/F12 (Thermo Fisher Scientific) with 2% B27 Supplement (Thermo Fisher Scientific), 1% GlutaMAX (Thermo Fisher Scientific), 25 ng/mL BMP4 (PeproTech), and 8 µM CHIR99021 (FUJIFILM Wako Pure Chemicals), and the cells were incubated for three days. The mesoderm induction medium was replaced with an EC induction medium composed of StemPro-34 SFM (Thermo Fisher Scientific) supplemented with 2 mM L-Glutamine (Thermo Fisher Scientific), 200 ng/mL VEGF-A (PeproTech) and 2 µM forskolin (Sigma Aldrich), and the cells were incubated for an additional three days. On Day 7 of differentiation, the medium was replaced with an EC induction medium without 2 µM forskolin (Sigma Aldrich). On Day 8 of differentiation, 1.0 × 106 ECs were replated on a fibronectin-coated dish and allowed to proliferate for 2 passages in an EC maintenance medium composed of StemPro-34 SFM (Thermo Fisher Scientific) supplemented with 2 mM L-glutamine (Thermo Fisher Scientific), 50 ng/mL VEGF-A (PeproTech), 20 ng/mL bFGF (PeproTech) and 10 ng/mL epidermal growth factor (EGF; PeproTech). During these steps toward differentiation, the expression levels of several endothelial cell surface molecules that are known markers for endothelial differentiation were monitored by flow cytometry. The following antibodies were used: anti-CD31 antibody (1:5; clone WM59; BD Biosciences, 555,445), anti-CD144 antibody (1:5; clone 55-7H1; BD Biosciences, 560,410), anti-CD34 antibody (1:20; clone 8G12; BD Biosciences, 340,441), anti-CD304 antibody (1:50; clone AD5-17F6; Miltenyi Biotec 130–114-041), anti-CD157 antibody (1:20; clone SY/11B5; BD Biosciences, 564,214), anti-CD140b antibody (1:5; clone 28D4; BD Biosciences, 558,821), and anti-CD30 antibody (1:20; clone BerH8; BD Biosciences, 563,500). We performed functional assays to verify the endothelial nature of the HyPSC-derived ECs by testing for EC capillary tube formation, which is characteristic of the angiogenesis of ECs. The ECs at passage 2 were seeded at a density of 1.0 × 105 cells per well onto a 24-well plate coated with Matrigel (Corning, 354,234) and cultured for 24 h at 37 °C allowing them to form capillary tubes. The formation of capillary-like networks was monitored under a microscope.

Differentiation to hepatocytes

Hepatic differentiation from HyPSCs was performed according to the published protocols with some modifications [27,28,29]. Briefly, 6.0 × 105 HyPSCs were seeded onto an iMatrix-511 (Matrixome)-coated 6-well plate and cultured in StemFit AK03N (Ajinomoto) supplemented with 10 µM Y-27632 (FUJIFILM Wako Pure Chemicals). On day 1, the medium was changed to RPMI-1640 (Thermo Fisher Scientific) supplemented with 20% StemFit for Differentiation (Ajinomoto), 3 µM CHIR99021 (FUJIFILM Wako Pure Chemicals), and 100 ng/mL Activin A (PeproTech). Sodium butyrate (0.5 mM; FUJIFILM Wako Pure Chemical) was added from Day 2 to Day 5. On Day 7, the medium was changed to Hepatocyte Culture Medium (HCM) without EGF (Lonza, Bazel, Switzerland) supplemented with 5% FBS (SAFC Biosciences, Melbourne, Australia), 20 ng/mL hepatocyte growth factor (HGF; PeproTech), 20 ng/mL Oncostatin M (PeproTech) and 100 nM dexamethasone (Sigma Aldrich). Albumin-positive cell ratio was evaluated by flow cytometric analysis at the end of culture (Day 30). Anti-albumin antibody (1:1000; clone 188,835; R&D Systems, Minneapolis, MN, IC1455A) was used. The urea synthesis activity, one of the hepatocyte-specific functions, was also assessed to confirm the hepatic differentiation of HyPSCs. Prior to the urea assay, the culture medium was changed to a fresh evaluation medium containing 1 mM ammonium chloride (FUJIFILM Wako Pure Chemical). After 24 h, the evaluation medium was collected, and the cells were harvested from each well with 0.05% Trypsin–EDTA. The urea concentration in the evaluation medium was measured by a QuantiChrom Urea Assay Kit (BioAssay Systems, San Francisco, CA). The urea production of HyPSC-derived hepatocytes was normalized to 1.0 × 106 cells per day.

T cell proliferation assay

THP-1 cells were treated with 50 ng/mL IFN-γ (R&D Systems) in RPMI1640 (Thermo Fisher Scientific) supplemented with 10% FBS (Biosera, Cholet, France) and 0.05 mM 2-mercaptoethanol (2-ME) for 2 days at a concentration of 4.0 × 105 cells/mL in a T75 flask. Similarly, hiPSC-derived HPCs were treated with 50 ng/mL IFN-γ (R&D Systems) in X-VIVO 15 medium (Lonza) supplemented with 10% Human Serum (Sigma Aldrich), 10 mM HEPES (Thermo Fisher Scientific), 1 × GlutaMAX Supplement (Thermo Fisher Scientific), 1 mM sodium pyruvate (Sigma Aldrich), 1 × MEM NEAA Solution (Thermo Fisher Scientific), 50 ng/mL FLT3L (R&D SYSTEMS), 50 ng/mL SCF (R&D SYSTEMS), and 50 ng/mL TPO (PeproTech) for 2 days at a concentration of 1.0 × 106 cells/mL in a 6-well plate. Then, the THP-1 cells and hiPSC-derived HPCs were treated with 10 µg/mL mitomycin C (Sigma Aldrich) for 2 h and co-cultured with HLA-mismatch human CD3+ T cells (Cellero, Lowell, MA, 1017, HLA types are listed in Table 3) in a 48-well plate for 7 days at an effector to target (E/T) ratio of 10:1 (effector: 2.0 × 105 cells, target: 2.0 × 104 cells) in a T cell stimulation medium (RPMI1640 [Thermo Fisher Scientific] supplemented with 10% FBS [Thermo Fisher Scientific], 10 mM HEPES [Thermo Fisher Scientific], 1 mM sodium pyruvate [Thermo Fisher Scientific], 1 × MEM NEAA Solution [Thermo Fisher Scientific], 0.1 mM 2-ME [Sigma Aldrich], 20 U/mL IL-2 [PeproTech], and anti-CD28/CD49d antibody [clone L293; BD Biosciences, 347690]). Then, the cells were labeled with 10 μM 5-ethynyl-2’-deoxyuridine (EdU; Thermo Fisher Scientific) for 2 h, harvested, and stained with anti-CD3 antibody (1:50; clone REA613; Miltenyi Biotec, 130–113-138), anti-CD4 antibody (1:50; clone REA623; Miltenyi Biotec, 130–113-225), and anti-CD8 antibody (1:50; clone BW135/80; Miltenyi Biotec, 130–113-160). After fixation and permeabilization, the cells were EdU labeled with the Click-iT Plus EdU Alexa Fluor 647 Flow Cytometry Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions and the labeled cells were detected by flow cytometry. The percentage of proliferative CD3+/CD4+ T cells and CD3+/CD8+ T cells were measured with a MACSQuant Analyzer 10 Flow Cytometer (Miltenyi Biotec).

Table 3 HLA types of CD3+ T cells and hiPSCsCytotoxicity by HLA-reactive CD8+ T cells

The cytotoxicity assay using HLA-reactive CD8+ T cells was performed according to published literature [10]. CD8+ T cells were obtained by sorting from CD3+ T cells (Cellero) using the EasySep Human CD8+ T Cell Isolation Kit (STEMCELL Technologies, Vancouver, BC). The IFN-γ treated WT hiPSC-derived HPCs were treated with 10 µg/mL mitomycin C (Sigma Aldrich) for 2 h. To prime CD8+ T cells to allogeneic HLA reactive CD8+ T cells, 5.0 × 104 mitomycin-treated HPCs and 5.0 × 105 CD8+ T cells were co-cultured in T cell stimulation medium for 7 days in a 96-well round bottom plate. Further, 8.5 × 105 HLA-reactive CD8+ T cells were co-cultured with 8.5 × 105 mitomycin-treated HPCs in RPMI1640 (Thermo Fisher Scientific) supplemented with 10% FBS (SAFC Biosciences), 2 µg/mL phytohemagglutinin (Sigma Aldrich), 50 ng/mL IL-7 (PeproTech) and 50 ng/mL IL-15 (PeproTech) for 4 days. To expand the pool of HLA-reactive CD8+ T cells, the cells were cultured in RPMI1640 (Thermo Fisher Scientific) supplemented with 10% FBS (SAFC Biosciences), 1 × Insulin-Transferrin-Selenium (Thermo Fisher Scientific), 50 µg/mL L-ascorbic acid (FUJIFILM Wako Pure Chemical), 50 ng/mL IL-7 (PeproTech), and 50 ng/mL IL-15 (PeproTech) for an additional 12 days, while the medium was exchanged every two days to adjust the cell concentration to 1.0 × 106 cells/mL. The IFN-γ treated hiPSC-derived HPCs were stained with 5 μM CellTrace reagent in CellTrace Violet Cell Proliferation Kit (Thermo Fisher Scientific) at a concentration of 2.0 × 106 cells/mL according to the manufacturer’s instructions. Fifty thousand labeled hiPSC-derived HPCs were co-cultured with the HLA-reactive CD8+ T cells at E/T ratios of 1:1, 2.5:1, 5:1, 10:1, and 20:1 for 3 h in RPMI1640 (Thermo Fisher Scientific) containing 10% FBS (Thermo Fisher Scientific). The cells were stained with SYTOX Green Dead Cell Stain (Thermo Fisher Scientific) and analyzed with a MACSQuant Analyzer 10 Flow Cytometer (Miltenyi Biotec). To assess the spontaneous death of the target and effector cells, the target cells alone (target cell control) were stained with CellTrace Violet (Invitrogen) and SYTOX Green (Thermo Fisher Scientific), and the effector cells alone (effector cell control) were stained with SYTOX Green (Thermo Fisher Scientific). The analysis was performed by splitting the FITC-A/VioBlue-A (Y-axis/X-axis) dot plot into quadrants based on the target and effecter cell control, followed by counting the number of events in each of four regions (upper right: UR, upper left: UL, lower right: LR, and lower left: LL) of the quadrant gate. The ratio of spontaneous death in the target cell control (DT) was determined by dividing UR by LR of the target cell control, and the ratio of spontaneous death in the effector cell control (DE) was determined by dividing UR by LL of the effector cell control. Cytotoxicity (% of lysis) was calculated by using the following equation.

$$}\left( }} \right) = \frac} - \left( } \times } + } \times }} \right)}}} + } - \left( } \times } + } \times }} \right)}} \times 100$$

Cytotoxicity by NK cells

WT hiPSCs, HLA class Ia/II DKO hiPSCs, and HyPSCs were treated with 25 ng/mL IFN-γ (R&D Systems) in AK03N (Ajinomoto) for 3 days. Then, the hiPSCs and K562 cells were labeled with a Calcein-AM Labeling Kit (Biolegend, San Diego, CA) at a concentration of 1.0 × 107 cells/mL according to the manufacturer’s instructions. The labeled cells were co-cultured with peripheral blood mononuclear cell (PBMC)-derived NK cells (Funakoshi, FN105, Tokyo, Japan) for 2 h at an E/T ratio of 5:1 (effector: 2.5 × 105 cells, target: 5.0 × 104 cells) in 500 μL of AK03N (Ajinomoto) containing 10 mM Y-27632 (FUJIFILM Wako Pure Chemical). The dead cells were stained with SYTOX Red Dead Cell Stain (Thermo Fisher Scientific) and analyzed with a MACSQuant Analyzer 10 Flow Cytometer (Miltenyi Biotec). To assess the spontaneous death of the target and effector cells, the target cells alone were stained with Calcein-AM (Thermo Fisher Scientific) and SYTOX Red (Thermo Fisher Scientific), and the effector cells alone were stained with SYTOX Red (Thermo Fisher Scientific). The analysis was performed as described above, except for splitting the APC-A/FITC-A (Y-axis/X-axis) dot plot.

Flow cytometry-based phagocytosis assay

The flow cytometry-based phagocytosis assay was performed according to the published protocol with slight modifications [30]. THP-1 cells were differentiated into macrophages by 48 h of incubation with 100 ng/mL phorbol 12-myristate 13-acetate (PMA; Adipogen Corp., San Diego, CA) followed by 48 h of incubation in RPMI medium (Thermo Fisher Scientific) [31]. The macrophages were stimulated by an additional 24 h of incubation with 10 ng/mL IFN-γ (R&D Systems) and 50 pg/mL lipopolysaccharide (LPS; Sigma-Aldrich). Prior to co-culture, target cells and the macrophages were stained with CellTrace Violet (Invitrogen) and CellTrace CFSE (Invitrogen) for each. Then, labeled-target cells were mixed with labeled macrophages in 96-well plates at an E/T ratio of a 1:5 (effector cells: 2.5 × 104 cells, target cells: 1.25 × 105 cells), and cultured for 2 h at 37 °C in a 5% CO2 incubator. After co-culture, the cells were detached by TrypLE Express enzyme solution (Thermo Fisher Scientific), stained with Cell Viability Solution (BD Biosciences), and analyzed with a MACSQuant analyzer 10 (Miltenyi Biotec). The analysis was performed as described above, except for splitting the VioBlue-A/FITC-A (Y-axis/X-axis) dot plot. The ratio of the background staining in the target cell (NOISET) was determined by dividing UR by UL of the target cell alone, and the ratio of the background staining in the effector cell (NOISEE) was determined by dividing UR by LR of the effector cell alone. Phagocytosis (%) was calculated by using the following equation.

$$Phagocytosis\left( \% \right) = \frac + UL \times Noise_ } \right)}} + UL \times Noise_ } \right)}} \times 100$$

Mice

NOD/Shi-scid IL2rgamma(null) (NOG) mice were purchased from In-Vivo Science Inc. (Kawasaki, Japan) and were kept in animal facilities under pathogen-free conditions with ad libitum access to water and food. All animal experiments were performed in accordance with the relevant institutional and national guidelines and regulations.