Patients

The samples used in this study have received consent from the Ethics Committee of Harbin Medical University Cancer Hospital and were conducted in conformity with the Declaration of Helsinki. All participants in the study received written informed consent. Between October 2020 and October 2021, samples of 22 female BC patients were collected from Harbin Medical University Cancer Hospital. All of these patients received postoperative RT, and there were 10 cases with local recurrence. The clinical information collected is shown in Table 1. Patients with local recurrence in the breast and/or lymph nodes after RT were defined as non-responders.

Table 1 Clinicopathological characteristics of BC patientsCell Lines and Culture

Human BC cells MDA-MB-231 cells (92020424, Merck KGaA, Darmstadt, Germany) were placed in L-15 medium (L5520, Merck KGaA) supplemented with 2 mM L-Glutamine (G7513, Merck KGaA) and 15% fetal bovine serum (FBS, F2442, Merck KGaA). BT-549 (HTB-122, American Type Culture Collection, Manassas, VA, USA) cells were placed in Roswell Park Memorial Institute-1640 (30-2001, American Type Culture Collection) medium containing 0.023 U/mL insulin (I9278, Merck KGaA) and 10% FBS. Both cell lines were grown at 37 °C in an incubator at 5% CO2.

Short Hairpin RNA (shRNA)-knockdown, Virus Packaging, and Lentiviral Infection

Human ZBTB14 shRNA and lentivirus for overexpression (oe)-ZBTB14 and oe-TMEM208 were designed and purchased from Origene (Beijing, China). MDA-MB-231 and BT-549 cells were lentivirally infected at a multiplicity of infection = 10. Cells were transferred to a medium containing puromycin (A1113803, Thermo Fisher Scientific Inc., Waltham, MA, USA) for three weeks and screened for cells with stable knockdown or overexpression.

Establishment of MDA-MB-231/RT-R and BT-549/RT-R Cells

Referring to the common protocol for RT of BC patients, MDA-MB-231 and BT-549 cells were exposed to small doses of X‑ray irradiation (2 Gy) using a 6-MV photon beam generated by Varian 21EX Linear Accelerator (13818, Varian Medical Systems, Palo Alto, CA, USA). The cells were irradiated 25 times at regular intervals (a total of 50 Gy). After the cells were treated with RT and grew to approximately 90% confluence, they were trypsinized and passaged into a fresh medium for further culture. Cells were irradiated when they reached 70% confluence, and thereafter, multiple irradiations were continued until the total dose reached 50 Gy [13]. Radioresistant BC cells (MDA-MB-231/RT-R and BT-549/RT-R) were developed and used for subsequent experiments.

In Vivo Tumor Experiments

All animal studies in this study were conducted following the guidelines provided by the Animal Ethics Committee of Harbin Medical University Cancer Hospital. Eight-week-old male BALB/C nude mice were purchased from Hunan SJA Laboratory Animal Co., Ltd. (Changsha, Hunan, China). MDA-MB-231/RT-R and BT-549/RT-R (2 × 106) infected with oe-NC, oe-ZBTB14, oe-ZBTB14 + oe-NC, and oe-ZBTB14 + oe-TMEM208 were injected subcutaneously into mice (n = 5/group). Tumor volumes were calculated by the formula (a × b2)/2, where a is the major tumor axis and b is the minor tumor axis. The mice were regularly treated with radiation (16 Gy once every 3 days) starting on day 15 [14]. On day 35, the mice were euthanized by intraperitoneal injection of sodium pentobarbital (150 mg/kg), and the tumors were harvested for subsequent experiments.

RNA Isolation and RT-qPCR

Tumor tissue from BC patients and xenograft tumor tissue from nude mice were first cut into 5 × 10 mm sections. Tumor sections and MDA-MB-231/RT-R and BT-549/RT-R with different treatments were homogenized with 1 mL of TRIzol Reagent (15596026, I-presci, Beijing, China). The homogenate was added with 200 µL of chloroform and briefly centrifuged to induce phase separation. The upper aqueous phase was transferred to a new tube, and isopropanol was added to precipitate the RNA, followed by a series of ethanol washes. After that, 1 µg of RNA was reverse transcribed to cDNA using the First Strand cDNA Synthesis Kit for RT-PCR (11483188001, Merck KGaA). RT-qPCR analysis was performed on a CFX Opus Deepwell Real-Time Fluorescence qPCR System using Premix Taq (RR003Q, Shanghai Zhengyu Biotechnology Co., Ltd., Shanghai, China). Relative gene expression was evaluated using the 2−ΔΔCt method with GAPDH mRNA as the endogenous control. Primers used were as follows: CTGCTACCATCAGGGACGTG and ACTGTCATCCTGATCCCCGA for ZBTB14; TGGTGCTTAGTGATTGCGGT and GATGAGATGCCGTCAGGAGG for TMEM208; and AATGGGCAGCCGTTAGGAAA and GCGCCCAATACGACCAAATC for GAPDH.

Immunohistochemistry (IHC)

Tumor tissues and xenograft tumors were fixed in 10% formalin, dehydrated, cleared, paraffin-embedded, and sectioned. The sections were heat-treated for antigen retrieval, treated with hydrogen peroxide, and sealed with BSA containing 0.3% goat serum. The sections were incubated with the antibodies including ZBTB14 (1:100, PA5-62236, Thermo Fisher Scientific Inc.), TMEM208 (1:250, 23882-1-AP, ProteinTech Group, Chicago, IL, USA), γ-H2AX (phospho S139, 1:100, ab81299, Abcam, Cambridge, UK), and Ki67 (1:1000, ab15580, Abcam) at 4 ℃ overnight, and with the horseradish peroxidase (HRP)-linked goat anti-rabbit IgG secondary antibody (1:100, HAF008, Novus Biological Inc., Littleton, CO, USA) for 1 h. The sections were sealed for microscopy observation after color development by diaminobenzidine and nuclei counter-staining with hematoxylin.

By recording the percentage of positive staining (0 = negative, 1 ≤ 10%, 2 = 10–50%, 3 ≥ 50%) and the intensity of staining (0 = absent, 1 = weak, 2 = moderate, 3 = strong), each sample from patients was scored by multiplying the percentage of positive staining with the intensity of staining [15]. The results were assessed by two pathologists who were unaware of the grouping information, and the final score was expressed as the average of the two experts’ scores. For IHC results of xenograft tumors, positive cell rates were counted by ImageJ.

Western Blot Assays

Tumor tissues or cells were treated with RIPA lysis and extraction buffer (89901, Thermo Fisher Scientific Inc.). The supernatant was collected by centrifugation and detected using a BCA Protein Assay Kit (GK10009, Glpbio, Montclair, CA, USA). The protein was separated on SDS-PAGE gels and transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% nonfat milk in phosphate-buffered saline (PBS)/Tween to prevent nonspecific binding and incubated with primary antibody overnight at 4 °C. All samples were incubated with goat anti-rabbit IgG secondary antibody [HRP] (1:1000, HAF008, Novus Biological) or goat anti-mouse secondary antibody [HRP] (1:5000, ab6728, Abcam) and detected via chemiluminescence detection system (E411-04; NanJing Vazyme Biotech Co., Ltd, Nanjing, China). Primary antibodies used in this study were as follows: ZBTB14 (1:1000, H00007541-M02, Thermo Fisher Scientific Inc.), TMEM208 (1:1000, 23882-1-AP, ProteinTech Group), and GAPDH (1:5000, NB300-327, Novus Biological).

Colony Formation Assay

MDA-MB-231/RT-R and BT-549/RT-R after different infections were seeded at 5 × 104 cells in six-well plates and incubated for 24 h under the desired culture conditions. The number of colonies formed in each well was counted under a microscope after 2 h of irradiation using different doses (0, 2, 4, 6 Gy) of γ-rays, and cell survival was calculated [16].

Wound Healing Assay

MDA-MB-231/RT-R and BT-549/RT-R after different infections were seeded at 2 × 105 cells/well in six-well plates. When the cells were growing at approximately 90% confluence, a 200 µL pipette tip was used to create a scratch on the confluent monolayer of cells. Detached cells were removed by PBS, and the cells were subjected to 8 Gy γ-irradiation [17]. The medium was replaced with DMEM containing 0.1% FBS every 12 h. Images were taken at the indicated time points (0 and 36 h) to calculate the wound healing rate.

Transwell Assay

Matrigel Basement Membrane Substrate (100 µL, CLS354234, Corning Glass Works, Corning, N.Y., USA) was applied to the apical chamber of the insert. MDA-MB-231/RT-R and BT-549/RT-R cells (2 × 105 cells/well) in serum-free medium were subsequently added to the apical chamber, and medium containing 10% FBS was loaded into the basolateral chamber for a 24-h incubation at 37 °C with 5% CO2), during which RT at 8 Gy was given. Uninvaded cells remaining on the upper surface of the membrane were rinsed using PBS. Cells invading the lower chamber were stained using a 5% crystal violet stain, and the stained cells were counted by microscopy.

Terminal Deoxynucleotidyl Transferase (TdT)-Mediated dUTP Nick end Labeling (TUNEL) and Immunofluorescence

TUNEL assay was performed using Click-iT Plus TUNEL Assay Kits (C10617, Thermo Fisher Scientific Inc.). MDA-MB-231/RT-R and BT-549/RT-R cells were seeded into a 12-well plate and fixed for 30 min using 4% paraformaldehyde. The cells were permeabilized with PBS containing 0.2% Triton X-100 for 15 min, sealed in PBS containing 2% BSA for 1 h, and incubated with 50 µL of TUNEL staining solution for 60 min at 37 °C in the dark or anti-γ-H2AX (1:250, ab81299, Abcam) overnight at 37 °C in the dark (8 Gy γ-irradiation). Before observation, DAPI (C0065, Beijing Solarbio Life Sciences Co., Ltd., Beijing, China) was used for counterstaining for 30 min (TUNEL staining), and immunofluorescence was performed with goat anti-rabbit IgG (H + L) Alexa Fluor 594 (1:2000, R37117, Thermo Fisher Scientific Inc.) at room temperature for 1 h. The cells were analyzed under a fluorescence microscope.

Flow Cytometry

After 8 Gy γ-irradiation, the cells were detached by trypsin and stained with 20 µg/mL of Annexin V-fluorescein isothiocyanate (FITC) (IF0080, Solarbio) and 50 µg/mL of propidium iodide (PI, P8080, Solarbio), while flow cytometry was performed to analyze the change in apoptosis rate.

Chromatin Immunoprecipitation (ChIP)

The BC cells were cross-linked using 1% formaldehyde at room temperature using the ChIP Assay Kit with Protein A/G Magnetic Beads (YTB3092, Biolab, Beijing, China) according to the manufacturer’s instructions, and the cross-linking reaction was terminated with glycine. Cells were resuspended in an SDS buffer solution and subjected to sonication to fragment the chromatin. The supernatant was collected by centrifugation and incubated with anti-ZBTB14 (1:20, sc-514298, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) or mouse IgG2a isotype control (1:50, ab18413, Abcam) at 4 °C overnight. Subsequently, 80 µL of Protein A/G magnetic beads were added and slowly rotated or oscillated for 60 min at 4 °C to precipitate. The magnetic beads were separated by placing them on a magnetic rack for 10 s. The supernatant was removed, and the magnetic beads were washed. The purified DNA was subjected to PCR for amplification.

Luciferase Report Assay

For the construction of the TMEM208 luciferase reporter gene, we inserted the TMEM208 promoter sequence obtained from UCSC (https://genome.ucsc.edu/cgi-bin/hgGateway) into the pMCS-Red Firefly Luc vector (16155, Thermo Fisher). The plasmid was co-transfected with oe-ZBTB14 into BC cells and incubated for 48 h. Luciferase activity was detected using the Luciferase Reporter Gene Assay Kit (11401ES76, Yeasen Biotechnology Co., Ltd., Shanghai, China).

Statistical Analysis

Statistical analyses were performed with GraphPad Prism 10.2.0 software (GraphPad, San Diego, CA, USA) and presented as mean ± SD of at least three independent experiments. Differences between any two variables were done by using the unpaired t-test. The significance of the differences among three or more groups was conducted by using one-way or two-way ANOVA with Tukey or Sidak post-test. p-values less than 0.05 were deemed statistically significant.