Cell Culture

HeLa cells were cultured in Eagle’s minimal essential medium (MEM) (Gibco, Karlsruhe, Germany) supplemented with 5% fetal calf serum (FCS), 0,02 M HEPES, 1% non-essential amino acids (NEAA) and 1% penicillin / streptomycin (P/S). HEK293T cells were cultured in DMEM High glucose (Biowest, Darmstadt, Germany) supplemented with 10% FCS, 1% P/S, 1% L-glutamine and 1% Na-pyruvate. The murine colorectal carcinoma cell lines Colon-26 and the human colorectal cancer cell lines DLD-1, Colo320, Colo205 and Colo680H were cultured in RPMI 1640 (c.c.pro, Oberdorla, Germany) supplemented with 10% FCS, 1% P/S, 1% L-glutamine and 2% Na-pyruvate. The human colorectal cancer cell line Caco-2 cells was cultured in DMEM High glucose (Biowest) supplemented with 10% FCS, 1% P/S, 1% L-glutamine, 1% NEAA and 2% Na-pyruvate. The murine colorectal CT-26Luc cells were cultured in RPMI 1640 (c.c.pro) supplemented with 10% FCS, 1% P/S, 1% L-glutamine, 1% NEAA and 2% Na-pyruvate.

Cell Killing Assay

1.5 × 105 Colo320 cells and 5 × 104 HeLa cells were seeded in 96-well plates and infected the next day with virus at a dose of MOI 0.1, 1 and 10 in 100 µl. After 1 h the medium was removed and 100 µl fresh medium was added. 24 h and 48 h later the medium was removed, cells were fixed with 10% trichloroacetic acid (TCA) (Carl Roth, Karlsruhe, Germany) and stained with 30 µl crystal violet solution (Carl Roth). The cells were washed three times with phosphate buffered saline (PBS) and then photographed.

Serial Passaging of PD-H in Colo320 Cells

Colo320 cells were seeded in 24-well (passage 1–8, each 8 × 105 cells), 12-well (passage 9, 1.6 × 106 cells) or 6-well (passage 10, 4 × 106 cells) plates. After 24 h, the medium was removed, and cells were infected with PD-H at MOI 0.1 in fresh medium for 1 h. Cells were washed with PBS and fresh culture medium was added (24-well 500 µl, 12-well 1 ml, 6-well 2 ml). After incubation for 72 h viruses were isolated by three freeze-thaw cycles, cell debris was removed by centrifugation and virus titer in supernatant was determined by plaque assay on HeLa cells. The isolated virus batches were named according to their passage. The viruses were stored at -80 °C until use in the next round of passaging. In each further round 0.1 MOI of virus obtained from the previous round of passaging was applied to fresh Colo320 cells. In total 10 virus batches (PD-1 to PD-10) were generated.

Virus Plaque Assay

HeLa cells were seeded in 24-well plates as confluent monolayers. After 24 h, medium was removed, and cells were incubated for 30 min with 300 µl of serial 10-fold dilutions of virus-containing samples in PBS. After removing the supernatant cells were overlaid with 3.2% BD-Difco Noble Agar (Thermo Fisher Scientific, Waltham, USA) containing Eagle’s minimal essential medium (MEM) (Gibco). Seventy-two h after virus infection HeLa cells were stained with Tetrazoliumbromid-Iodnitrotetrazoliumchlorid solution (both VWR International GmbH, Darmstadt, Germany) and incubated for 4 h before plaque counting.

Virus Growth Curves

For generation of viral growth curves, 1.5 × 105 Colo320 cells were seeded in 96-well plates. After 24 h, medium was removed, and cells were infected with 100 µl virus suspension at MOI 0.1 and incubated for 1 h. Afterwards the medium was removed and 200 µl fresh medium was added. Cells were disrupted by three freeze-thaw cycles 0, 4, 8, 24, 48 and 72 h post infection. The cell lysate was centrifuged, and the supernatant was used for determination of virus titers by plaque assay on HeLa cells.

Cell Viability Assay

Cell viability was assessed by using Cell Proliferation Kit (XTT) (Promega GmbH, Walldorf, Germany) according to the manufacturer’s instructions. Cells were seeded in 96-well plates and infected the next day when they reached a confluence of about 80%. Twenty-four h, 48–72 h after infection absorbance levels were measured using the TriStar2 LB 942 Modular Multimode Microplate Reader (Berthold Technologies, Bad Wildbad, Germany). As negative control, cells were treated with 50 µl 5% Triton X-100 solution.

Mutagenesis and Cloning of PD-H cDNA-containing Plasmids

Mutagenesis was done by the In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan) according to manufacturer’s instructions. The mutagenesis-primers were designed using the online infusion primer designing tool (Takara Bio). Eight different plasmids were generated by mutagenesis of the plasmid pJet-CVB3-PD-H [24] containing the cDNA of the oncolytic CVB3 PD-H [24]. These plasmids were named as follows and contain nucleotide substitutions leading to substitution of certain amino acids (aa) in the viral polyprotein (shown in parenthesis), pJET-CVB3-PD-K4 (A3T), pJET-CVB3-PD-K1 (E596V, E768D), pJET-CVB3-PD-K2A (Y940C), pJET-CVB3-PD-K2B (N1027D), pJET-CVB3-PD-K2AB (Y940C, N1027D), pJET-CVB3-PD-K1-2AB (E596V, E768D, Y940C, N1027D), pJET-CVB3-PD-SK (A3T, E596V, E768D, Y940C, N1027D). A further plasmid, pJet-CVB3-PD-SK-375TS (A3T, E596V, E768D, Y940C, N1027D) was generated by mutagenesis of the plasmid pJet-CVB3-PD-H-375TS [24] containing the PD-H cDNA with two target sites of the miR-375 in the 3’ UTR [24].

Generation of Recombinant Viruses

HEK293T cells were seeded into 6-well plates and next day at a confluence of 70–80% transfected with 2.5 µg of plasmids containing viral cDNA using PEImax (Polysciences Europe GmbH, Hirschberg an der Bergstraße, Germany). The viruses PD-H and PD-H-375TS were generated by transfection of the plasmids pJET-CVB3-PD-H [24] and pJET-CVB3-PD-H-375TS [24]. The viruses PD-K1, PD-K4, PD-K2A, PD-K2B, PD-K2AB, PD-K1-2AB, PD-SK, and PD-SK-375TS were generated by transfection of plasmids containing the corresponding viral cDNAs. Seventy-two h after transfection cells were disrupted by three freeze-thaw-cycles. The cell lysate was centrifuged, and the supernatant was used for determination of virus titers by plaque assay on HeLa cells. Viruses were amplified by infection of HEK293T with 0.3 MOI of viruses. For in vivo studies PD-H-375TS and PD-SK-375TS were purified and concentrated by ultracentrifugation with 30% sucrose gradient as described previously [25].

Sequencing of CVB3 Genome

The whole genome of PD-5 and PD-10, and all mutated sites of the engineered PD-H variants were sequenced. Therefore, viral RNA was extracted with the NucleoSpin RNA Virus Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions and reverse transcribed by using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, USA). PCR fragments were generated with Q5® High-Fidelity DNA Polymerase (New England Biolabs, Frankfurt, Germany) using CVB3 specific primers and sequenced by sanger sequencing by LGC Biosearch Technolgies (Berlin, Germany). Sequence alignment was done with SnapGene 5.1.7 software.

Comparison of aa Substitutions Found in PD-10 with Other CVB3 Strains

PD-H according to [24]. The other strains can be found at the National Center for Biotechnology Information (NCBI) with the following accession numbers. Strain 0 AY752945.1; strain 20 M88483.1; strain 2035 A KY286529.1; strain 28 AY752944.2; strain 31-1-93 AF231763.1; strain H3 U57056.1; strain L M16572.1; strain M2 M33854.1; strain Nancy JX312064.1; strain P AF231764.1 and strain RD HQ157560.1.

Virus Attachment and Uptake Assay

Colo320 cells were seeded in 24-well plates. Next day when cells reached a confluence of 80% the cells were washes with ice cold PBS, then incubated with 0.1 MOI virus in a volume of 500 µl ice cold cell culture medium on ice for 1 h. The medium was removed, the cells washed twice with ice cold PBS. To determine virus attachment thereafter the cells were immediately frozen to -80 °C. After three freeze-thaw-cycles the supernatant was used for viral RNA extraction. To determine virus uptake the cells were infected as described, overlaid with 500 µl cell culture medium and incubated for further 30 min at 37° C. The medium was removed, the cells were washed twice with icecold PBS and total RNA from cells was isolated using TRIZOL reagent (Life Technologies, Carlsbad, USA). RT-PCR was used to determine virus genome copy number.

Determination of Virus Genome Copy Number by Quantitative RT-PCR

For quantification of viral genomic RNA, total RNA from virus infected cells was isolated using the NucleoSpin RNA Virus Kit (Macherey-Nagel) or using TRIZOL reagent (Life Technologies) according to the manufacturer’s instructions and reverse transcribed by using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR was performed using the CVB3 specific forward primer, 5’-CCCTGAATGCGGCTAATCC and the reverse primer 5’- ATTGTCACCATAAGCAGCCA in SsoFastTM EvaGreen Supermix (Bio-Rad Laboratories, Hercules, USA). Cycle times were one cycle at 50 °C for 2 min followed by 94 °C for 10 min and 40 cycles at 94 °C for 15s and 60 °C for 60s. A standard curve was used to calculate the number of viral genome copies. The RNA copies were determined by the ΔΔCt calculation method.

Western Blots

Colo320 cells were seeded in 6-well plates. Twenty-four h later when cells reached a confluence of 80% the cells were infected with PD-H and PD-SK at MOI 0.1. Twenty-four h later cells were washed with PBS and trypsinated. Cell suspension was centrifuged, supernatant removed, and cell pellet immediately frozen at -80 °C. Cells were treated with lysis buffer (20 mM TRIS/HCl, pH 8.0, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1% protease inhibitor cocktail) (Sigma-Aldrich, Taufkirchen, Germany) and 1% phosphatase inhibitor cocktail (Calbiochem, San Diego, USA). Protein concentration was measured by a BCA assay (Thermo Fisher Scientific). Cell extracts were separated by SDS/PAGE and immunoblotted with primary antibody anti-γ-tubulin (T6557) (Sigma-Aldrich), selfmade mAb against CVB5-VP1 which binds CV-1 of CVB3 [26], anti-eIF4G (N-20) (Santa Cruz Biotechnology, Dallas, Texas, USA), anti-cleaved caspase 3 (Asp175, #9661), anti-caspase 8 (1C12, #9746), anti-caspase 9 (C9, #9508) and anti-PARB (#9542) (all Cell Signaling Technology, Danvers, MA, USA). The monoclonal anti-VP1 antibody was generated against VP1 from CVB5 strain Faulkner. For detection the membrane was blocked with 5% dry milk/PBS-T and incubated overnight at 4 °C with the respective antibodies. Subsequently the membrane was washed three times with PBS-T and incubated with goat anti-mouse and anti-rabbit IgGs conjugated to horseradish peroxidase (Bio-Rad, Hercules, USA) in 5% dry milk/PBS-T for 1 h. Magic MarkXP (Thermo Fisher Scientific) was used as a molecular weight marker to determine size of detected proteins after western blotting. Chemiluminescence was performed using the Supersignal West Pico Substrate (Thermo Fisher Scientific) and detected with Imager 600 from GE Healthcare (Chalfont St Giles, UK). Quantification of the expression of indicated genes was carried out relative to the expression of γ-tubulin by densitometric analysis using the ImageJ densitometry software.

Fluorescence Imaging

Colo320 cells were seeded in 24-well plates and were infected the next day when cells reached a confluence of about 80% with PD-H and PD-SK at MOI 0.1. Twenty-four h after infection cells were fixed with 4% formaldehyde (Carl Roth) for 15 min, washed three times with PBS and incubated with 500 µl blocking solution (PBS, 5% goat serum, 0.3% Triton X-100) for 1 h. Blocking solution was removed, and cells were incubated with primary antibody for cleaved caspase-3 (Cell Signaling Technology) at 4 °C overnight. After washing with PBS, incubation with secondary antibody Goat anti-Rabbit IgG (H + L) Alexa Fluor™ 488 (Thermo Fisher Scientific) was carried out for 2 h. Thereafter, cells were washed three times with PBS followed by co-staining with 1 µg/mL of 40,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) for 10 min. Cells were washed twice again with PBS and images were taken by fluorescence microscopy (Observer Z1, Carl Zeiss, Oberkochen Germany).

Caspase-3/7 Activities

Caspase-3/7 activities were measured using Caspase-Glo® 3/7 Assay Systems (Promega GmbH) according to the manufacturer’s instructions. Cells were seeded in 96-well plates and were infected the next day when cells reached a confluence of about 80% at MOI of 0.1 and 0.01. Twenty-four h after infection luminescence was measured using the TriStar2 LB 942 Modular Multimode Microplate Reader (Berthold Technologies, Bad Wildbad, Germany).

Quantification of MicroRNA Levels

For quantification of miR-375 level, total RNA from cells or mouse tissues was isolated by using TRIZOL reagent (Life Technologies). RNA was reverse transcribed by using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Expression levels of miR-375 (assay ID: 000564) were determined by utilizing the TaqMan gene expression master mix and specific TaqMan gene expression assays (Life Technologies) according to the manufacturer’s instructions. The data were analyzed by using the ΔΔCt method, and results were normalized against U6 snRNA (assay ID: 001973) levels of cell lines and tissues.

MicroRNA-dependent Virus Silencing

HEK293T cells were seeded in 24-well plates and transfected the next day when they reached a confluence of about 70–80% with 800 ng of the plasmid pCMV-miR-375 expressing the miR-375 or the plasmid pCMV-GFP-miR-216 expressing GFP protein and the miR-216. Both plasmids were purchased from Origene Technologies (Rockville, MD, USA). Transfection was done using PEImax (Polysciences Europe GmbH). Forty-eight h post transfection cells were inoculated with PD-SK-375TS at MOI 0.01 for 30 min at 37 °C. After removal of viral solutions, fresh medium was added. Twenty-four h post infection cells were disrupted by three freeze-thaw-cycles, the cell lysate was centrifuged, and the virus containing supernatant was used for determination of virus titers by plaque assay in HeLa cells.

Xenografted Subcutaneous Colo320 Cancer Mouse Model

The animal experiments were performed in accordance with the principles of laboratory animal care and all German laws regarding animal protection and approved by the responsible local authorities (State Office of Health and Social Affairs, Berlin, Germany, reference number G 0048/18). For generation of Colo320 tumors, 6-week-old female Balb/C nude mice (Charles River, Sulzfeld, Germany) were injected with 5 × 106 cells subcutaneously into the right and left flank. After 9 days, when tumor reached a diameter of approximately 5 mm, one of the tumors was injected with 3 × 106 PFU of PD-H-375TS or PD-SK-375TS, each in 30 µl PBS. Control animals were injected with 30 µl PBS. Tumor volume was measured every two days. The maximal tumor size/burden permitted by ethics committee was 1,8 cm3. The maximal tumor size/burden was not exceeded in the experiments.

Histopathological Analysis

For histopathological analysis tissues were fixed with 4% paraformaldehyde (Carl Roth) and embedded in paraffin. The tissue was cut in 5 μm-thick sections and stained with hematoxylin and eosin (H&E) to visualize inflammation and tissue destruction.

Statistical Analysis

Statistical analysis was performed with Graph-Pad Prism 8.2 Software. Results are expressed as the mean SEM for each group. Statistical significance was determined by use of the two-tailed unpaired Student’s t-test for cell culture investigations and by use of the Mann-Whitney U-test for in vivo investigations. Differences were considered significant at p < 0.05.