Cell culture and reagents

The SK-N-SH cells were purchased from the Cell Resource Center, Peking Union Medical College (the headquarters of the National Science & Technology Infrastructure, National BioMedical Cell-Line Resource, NSTI-BMCR). The cells were cultured in DMEM-H medium (M&C Gene Technology, Beijing, China) with 10% fetal bovine serum (FBS, Gibco, Auckland, New Zealand). The SK-N-SH cells were cultured in incubator with 5% CO2 at 37 °C. Astaxanthin was obtained from Sigma-Aldrich (St. Louis, MO, USA).

MTT assay

SK-N-SH cells were prepared in a single cell suspension and inoculated into a 96-well plate at a volume of 200µL per well (5000 cells per well). The cells were cultivated for 72 h with different concentrations (0, 50, 100, 200 and 400 µM) of drugs in 100µL of medium. Then, 20µL of MTT solution was added. After 4 h, cultivation was stopped. The culture medium from each well was carefully absorbed and discarded. Each well was then shaken for 10 min with 150ul of DMSO decolorization shaker to ensure the crystals fully dissolved. The absorption value of each well was measured using an ELISA reader (Cayman Chemical, Ann Arbor, MI, USA) at a wavelength of 490 nm and the results were recorded.

Colony formation assay

Treatment: The experiment was divided into five groups: CK, si-NC (siRNA-NC), astaxanthin, si-STAT3 and astaxanthin + si-STAT3. The si-NC(siRNA-NC) and si-STAT3 groups were separately transfected with an siRNA-NC plasmid or si-STAT3, respectively, for 48 h. Then, all the groups were given astaxanthin (200 µ m) for 24 h.

Clone formation experiment: After 14 days of culture, the culture media were discarded. The cells were rinsed twice with PBS. After 4% paraformaldehyde fixation for 20 min, two PBS rinses, 0.1% crystal violet staining for 20 min, another two PBS rinses and drying, the photograph was taken.

Flow cytometry assay

Apoptosis was detected using an Annexin V-FITC/PI assay. Cells were digested with trypsin, centrifuged and collected. The cells were then washed with PBS twice and centrifuged at 4 °C for 5 min; a total of 1*105 cells were collected. The cells were resuspended in 100 µL of buffer and 5 µL FITC and 5 µL PI stain solution were added. Following incubation for 5 min in the dark, the cells were supplemented with 500 µL of buffer and apoptosis was checked and measured using flow cytometry (Columbus 2.4, PerkinElmer, Waltham, MA, USA).

Cell migration and cell invasion assay

A migration transwell with two chambers was used to detect the migration of the SK-N-SH cells. The SK-N-SH cells from each group were collected and resuspended in 2% serum medium. Then, the cells were inoculated into the upper chamber, while culture medium with 10% serum was added to the lower chamber. After 16 h, the SK-N-SH cells were fixed with 4% paraformaldehyde. The cells in the upper layer of the lower chamber membrane were wiped off, stained with crystal violet for 20 min, washed with PBS twice, dried and photographed.

An invasion transwell with two chambers was used to detect cell invasion. The upper chamber was pretreated with Matrigel. Then, the cells were resuspended in 2% serum medium and inoculated into the upper chamber. Culture medium with 10% serum was added to the lower chamber. After 16 h, the SK-N-SH cells were fixed with 4% paraformaldehyde. The cells in the upper layer of the lower chamber membrane were wiped off, stained with crystal violet for 20 min, washed with PBS twice, dried and photographed.

Western blot

Cells from each of the five groups were placed in a culture dish and cultivated for 24 h, and protein was extracted after drug treatment. Protein concentrations were checked and measured using a BCA protein quantitative kit (Tiangen, Beijing, China; PA102). An equivalent of 30 µg protein was collected from each group, boiled for 15 min, loaded onto SDS-PAGE and then transferred onto a PVDF membrane. The PVDF membrane was blocked with milk for 1.5 h, rinsed with PBS 3 times and then incubated with antibodies diluted to 1:1000 or 1:500 overnight at 4 °C. The primary antibodies used included anti-Bax (1:1000, ab7977, Abcam, USA), anti-Bcl-2 (1:1000, ab692, Abcam), anti-Caspase-3 (1:1000, ab32351, Abcam), anti-Caspase-9 (1:1000, ab32539, Abcam), anti-NF-kβp65 (1:1000, ab76302, Abcam), anti-JAK2 (1:1000, ab92552, Abcam), anti-Stat3 (1:1000, ab119352, Abcam), and anti-β-actin (1:1000, ab8227, Abcam).

Following primary antibody incubation, the PVDF membranes were incubated with the diluted 1:1000 secondary antibodies for 2 h and rinsed with PBS three times. The internal reference was β-actin.

RT-PCR

Cells from the five groups were placed in a culture dish and incubated for 24 h. Total RNA was collected using Baosai lysis reagent (Baosai, Hangzhou, China; RE02050). Reverse transcription was carried out with the extracted total RNA from the cells (1 µg) using a Revert Aid First Strand cDNA synthesis kit (Baosai; RT02020). A fluorescence quantification kit (Baosai;Å PM10003) was used in qRT-PCR, where 40 g of cDNA was used as the template.

The primer sequences were as follows: Caspase3-F: ATCCAGTCGCTTTGTGCCAT; Caspase3-R: TTCTGTTGCCACCTTTCGGT; Bcl2-F: GCCTTCTTTGAGTTCGGTG; Bcl2-R: AGTCATCCACAGGGCGAT; Casp9-F: TGGGCTCACTCTGAAGACCT; Casp9-R: AGCAACCAGGCATCTGTTTA; NF-κB-F: GTTTCCGTTACAAGTGCGAG; NF-κB-R: TTGGGTGCGTCTTAGTGGTA; JAK2-F: AGTAAAGATGCCTTCTGGTGAA; JAK2-R: TCCATTTCCAAGTTCTCCACT; STAT3-F: AATACCATTGACCTGCCGATGT; STAT3-R: GGGTTCAGCACCTTCACCAT; GAPDH-F: TTTGGTATCGTGGAAGGACT; GAPDH-R: GAGGCAGGGATGATGTTCT.

Construction of SK-N-SH tumor model

A total of thirty nude mice were obtained from Sibeifu Biotechnology Co., Ltd. Lethal by inhalation of carbon dioxide, and were randomly divided into five groups as follows:

Group A: Blank control (gastric saline infusion).

Group B: Blank transfection group (transfected with a blank vector).

Group C: Nude mice were given astaxanthin once a day at a concentration of 200 mg/kg. The weight of the nude mice was about 20 g and the astaxanthin concentration was 200 mg/ml.

Group D: Intervention group.

Group E: Intervention combined with intragastric astaxanthin administration.

For the construction of the SK-N-SH tumor model, the nude mouse was injected with 2 × 107 logarithmic-phase SK-N-SH cells in the left armpit. Two weeks after inoculation, tumor-bearing nude mice underwent different treatments based on their groups.

After 4 weeks of continuous intragastric administration, the nude mice were killed and tumor tissues were extracted and weighed for the experiments.

Ethics statement

All experiments were conducted strictly according to the institutional guidelines for animal research and were approved by the Committee on the Ethics of Animal Experiments of Beijing Union University (CIHFBUU-ZYZDS-B01-15-01).

TUNEL assay

Paraffin sections were dewaxed with distilled water and washed with PBS 3 times for 5 min. Then, the sections were treated with proteinase K working solution at 37℃ for 30 min, washed with PBS 3 times for 5 min, treated with H2O2 at room temperature for 10 min and washed with PBS 3 times for 5 min. TdT enzyme reaction solution was added at 37℃ for 60 min in the dark, then the sections were washed with PBS 3 times for 5 min. The sections were treated with Streptavidin-HRP solution at 37 ℃ for 30 min in the dark and washed with PBS 3 times for 5 min. Following DAB color rendering, three five-minute PBS washes and post-treatment hematoxylin sealing, open field panoramic scanning was carried out.

Statistical analysis

A Student’s t-test was used to determine whether there was a statistically significant difference between the two groups. P < 0.05 indicated statistical significance.