Figure 1. NMN intervention for 7 days ameliorates silica-induced lung injury in mice. (A) Lung weight coefficient (the ratio of lung wet weight to body weight) increased during injury induced by silica; (B) Ashcroft scores of lung tissue—associated with the severity of lung lesions— increased after silica induction; (C) collagen volume fraction of lung tissue—an indicator of collagen fibers’ expression in tissues—where silica induced deposition of collagen fibers in lung tissues; (D) H&E staining images of lung tissue; (E) Masson staining images of lung tissue. Scale: 4×, 20×, the images for 20× are derived from the red box in 4×. # indicates p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 vs. Vehicle. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 1. NMN intervention for 7 days ameliorates silica-induced lung injury in mice. (A) Lung weight coefficient (the ratio of lung wet weight to body weight) increased during injury induced by silica; (B) Ashcroft scores of lung tissue—associated with the severity of lung lesions— increased after silica induction; (C) collagen volume fraction of lung tissue—an indicator of collagen fibers’ expression in tissues—where silica induced deposition of collagen fibers in lung tissues; (D) H&E staining images of lung tissue; (E) Masson staining images of lung tissue. Scale: 4×, 20×, the images for 20× are derived from the red box in 4×. # indicates p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 vs. Vehicle. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 2. NMN intervention for 28 days ameliorates silica-induced lung injury in mice. (A) Lung weight coefficient (the ratio of lung wet weight to body weight) increased during injury induced by silica; (B) Ashcroft scores of lung tissue—associated with the severity of lung lesions—increased after silica induction; (C) collagen volume fraction of lung tissue—an indicator of collagen fibers expression in tissues—where silica induced deposition of collagen fibers’ in lung tissues; (D) H&E staining images of lung tissue; (E) Masson staining images of lung tissue. Scale: 4×, 20×, the images for 20× are derived from the red box in 4×. # indicates p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 vs. Vehicle; ** p < 0.01, NMN-H vs. NMN-L. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 2. NMN intervention for 28 days ameliorates silica-induced lung injury in mice. (A) Lung weight coefficient (the ratio of lung wet weight to body weight) increased during injury induced by silica; (B) Ashcroft scores of lung tissue—associated with the severity of lung lesions—increased after silica induction; (C) collagen volume fraction of lung tissue—an indicator of collagen fibers expression in tissues—where silica induced deposition of collagen fibers’ in lung tissues; (D) H&E staining images of lung tissue; (E) Masson staining images of lung tissue. Scale: 4×, 20×, the images for 20× are derived from the red box in 4×. # indicates p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 vs. Vehicle; ** p < 0.01, NMN-H vs. NMN-L. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 3. NMN intervention regulates the expression of ROS and GSH in silica-induced lung injury. (A) Histogram of ROS levels from flow cytometry after exposure to silica for 7 d; (B) histogram of ROS levels from flow cytometry after exposure to silica for 28 d; (C) expression of ROS in lung tissue at 7 d, analyzed using mean fluorescence intensity from flow cytometry; (D) expression of ROS in lung tissue at 28 d, analyzed using mean fluorescence intensity from flow cytometry; (E) expression of GSH in lung tissue at 7 d; (F) expression of GSH in lung tissue at 28 d. # indicates p < 0.05, ### p < 0.001, #### p < 0.0001 vs. Vehicle; ** p < 0.01, *** p < 0.001, NMN-H vs NMN-L. ROS: reactive oxygen species, GSH: glutathione. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 3. NMN intervention regulates the expression of ROS and GSH in silica-induced lung injury. (A) Histogram of ROS levels from flow cytometry after exposure to silica for 7 d; (B) histogram of ROS levels from flow cytometry after exposure to silica for 28 d; (C) expression of ROS in lung tissue at 7 d, analyzed using mean fluorescence intensity from flow cytometry; (D) expression of ROS in lung tissue at 28 d, analyzed using mean fluorescence intensity from flow cytometry; (E) expression of GSH in lung tissue at 7 d; (F) expression of GSH in lung tissue at 28 d. # indicates p < 0.05, ### p < 0.001, #### p < 0.0001 vs. Vehicle; ** p < 0.01, *** p < 0.001, NMN-H vs NMN-L. ROS: reactive oxygen species, GSH: glutathione. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 4. NMN intervention for 7 days decreases the proportion of macrophages, CD4 + CD69 + T cells, and CD8 + CD69 + T cells in silica-induced lung injury. (A) Proportions of macrophages in lung tissue; (B) proportions of CD4 + CD69 + T cells in lung tissue; (C) proportions of CD8 + CD69 + T cells in lung tissue. ## indicates p < 0.01, ### p < 0.001, #### p < 0.0001 vs. Vehicle). Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 4. NMN intervention for 7 days decreases the proportion of macrophages, CD4 + CD69 + T cells, and CD8 + CD69 + T cells in silica-induced lung injury. (A) Proportions of macrophages in lung tissue; (B) proportions of CD4 + CD69 + T cells in lung tissue; (C) proportions of CD8 + CD69 + T cells in lung tissue. ## indicates p < 0.01, ### p < 0.001, #### p < 0.0001 vs. Vehicle). Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 5. NMN intervention for 28 days decreases the proportion of macrophages, CD4 + CD69 + T cells, and CD8 + CD69 + T cells in silica-induced lung injury. (A) Proportions of macrophages in lung tissue; (B) proportions of CD4 + CD69 + T cells in lung tissue; (C) proportions of CD8 + CD69 + T cells in lung tissue. #### indicates p < 0.0001 vs. Vehicle. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 5. NMN intervention for 28 days decreases the proportion of macrophages, CD4 + CD69 + T cells, and CD8 + CD69 + T cells in silica-induced lung injury. (A) Proportions of macrophages in lung tissue; (B) proportions of CD4 + CD69 + T cells in lung tissue; (C) proportions of CD8 + CD69 + T cells in lung tissue. #### indicates p < 0.0001 vs. Vehicle. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 6. NMN protects against silica-induced lung injury through immune response and GSH-related metabolism pathways. (A) GO analysis of lung tissue transcriptomic sequencing; (B) KEGG analysis of 30 differentially expressed genes from GO analysis; (C) relative expression of Gstm1 mRNA in lung tissue at 7 d; (D) relative expression of Gstm1 mRNA in lung tissue at 28 d; (E) relative expression of Mgst1 mRNA in lung tissue at 7 d; (F) relative expression of Mgst1 mRNA in lung tissue at 28 d. ## indicates p < 0.01, #### p < 0.0001 vs. Vehicle. ** p < 0.01, **** p < 0.0001, NMN-H vs NMN-L. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 6. NMN protects against silica-induced lung injury through immune response and GSH-related metabolism pathways. (A) GO analysis of lung tissue transcriptomic sequencing; (B) KEGG analysis of 30 differentially expressed genes from GO analysis; (C) relative expression of Gstm1 mRNA in lung tissue at 7 d; (D) relative expression of Gstm1 mRNA in lung tissue at 28 d; (E) relative expression of Mgst1 mRNA in lung tissue at 7 d; (F) relative expression of Mgst1 mRNA in lung tissue at 28 d. ## indicates p < 0.01, #### p < 0.0001 vs. Vehicle. ** p < 0.01, **** p < 0.0001, NMN-H vs NMN-L. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 7. NMN regulates the expression of Nrf2 in silica-induced lung injury. (A) The relative expression of Nfe2l2 mRNA in lung tissue at 7 d; (B) relative expression of Nfe2l2 mRNA in lung tissue at 28 d; (C) expression of Nrf2 protein in lung tissue at 7 d; (D) expression of Nrf2 protein in lung tissue at 28 d; (E) expression and distribution of Nrf2 in lung tissue detected by immunohistochemical staining. Scale: 20×, 63×. # indicates p < 0.05, ### p < 0.001, #### p < 0.0001 vs. Vehicle. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 7. NMN regulates the expression of Nrf2 in silica-induced lung injury. (A) The relative expression of Nfe2l2 mRNA in lung tissue at 7 d; (B) relative expression of Nfe2l2 mRNA in lung tissue at 28 d; (C) expression of Nrf2 protein in lung tissue at 7 d; (D) expression of Nrf2 protein in lung tissue at 28 d; (E) expression and distribution of Nrf2 in lung tissue detected by immunohistochemical staining. Scale: 20×, 63×. # indicates p < 0.05, ### p < 0.001, #### p < 0.0001 vs. Vehicle. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 8. Gstm1, Mgst1, and Nfe2l2 gene interaction analysis and the expression of Gstm2 in silica-induced lung injury. (A) Gstm1, Mgst1, and Nfe2l2 gene–gene interaction network analysis from GeneMANIA database, Nfe2l2 interacts with Gstm1 and Mgst1 genes via Gstm2; (B) relative expression of Gstm2 mRNA in lung tissue at 7 d; (C) relative expression of Gstm2 mRNA in lung tissue at 28 d. ## indicates p < 0.01, ### p < 0.001, #### p < 0.0001 vs. Vehicle. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 8. Gstm1, Mgst1, and Nfe2l2 gene interaction analysis and the expression of Gstm2 in silica-induced lung injury. (A) Gstm1, Mgst1, and Nfe2l2 gene–gene interaction network analysis from GeneMANIA database, Nfe2l2 interacts with Gstm1 and Mgst1 genes via Gstm2; (B) relative expression of Gstm2 mRNA in lung tissue at 7 d; (C) relative expression of Gstm2 mRNA in lung tissue at 28 d. ## indicates p < 0.01, ### p < 0.001, #### p < 0.0001 vs. Vehicle. Sham: saline + saline; Vehicle: silica + saline; NMN-H: silica + NMN (1000 mg/kg); NMN-L: silica + NMN (500 mg/kg); NMN-Con: saline + NMN (1000 mg/kg).

Figure 9. Silica induces oxidative imbalance in fibroblasts. (A) The relative expression levels of Gstm1, Gstm2, Mgst1, and Nfe2l2 in different types of lung cells after silica exposure, detected by single-cell RNA sequencing. (B) GO analysis of fibroblasts performed using single-cell sequencing data; (C) KEGG analysis of fibroblasts performed using single-cell sequencing data.

Figure 9. Silica induces oxidative imbalance in fibroblasts. (A) The relative expression levels of Gstm1, Gstm2, Mgst1, and Nfe2l2 in different types of lung cells after silica exposure, detected by single-cell RNA sequencing. (B) GO analysis of fibroblasts performed using single-cell sequencing data; (C) KEGG analysis of fibroblasts performed using single-cell sequencing data.

Table 1. Animal experiment design scheme.

Table 1. Animal experiment design scheme.

GroupsIntratracheal
Instillation (0 d)i.g. * (Daily)Number of Animals
(7 d)Number of Animals
(28 d)Control group (Sham)Normal saline
(80 μL)Normal saline35Model group (Vehicle)Silica
(50 mg/mL, 80 μL)Normal saline56NMN high-dose group (NMN-H)Silica
(50 mg/mL, 80 μL)NMN
(1000 mg/kg)56NMN low-dose group (NMN-L)Silica
(50 mg/mL, 80 μL)NMN
(500 mg/kg)56NMN control group (NMN-Con)Normal saline
(80 μL)NMN
(1000 mg/kg)35

Table 2. qRT-PCR primers used in this experiment.

Table 2. qRT-PCR primers used in this experiment.

Primer NameForward PrimerReverse PrimerGstm1CCATTGCCAAACCCTTTGCTTGACCTTGTCCCCTGCAAACMgst1GCTCGGATCTACCACACCATTGCCTCCTTAGCAGCCTGTAAGCCATTGGstm2GAGAGACAGAGGAGGAGAGGATTCGTCTCAAAGTCAGGGCTGTAGCAAACNfe2l2AAGCACAGCCAGCACATTCTCCTGACCAGGACTCACGGGAACTTCGsto1GCCCGAGTGGTTCTTTGAGAGTGCCTTCTTGTACGGGTCAGsta4TGTATGGGAAGGACCTGAAGGAGAGATGGAGCCACGGCAATCATCATCβ-actinGAGGTATCCTGACCCTGAAGTACACACGCAGCTCATTGTAGA