Cell lines

The gastric cancer cell NCI-N87 and MGC-803 were purchased from ATCC, the human peritoneal mesothelial cell line HMrSV5 and gastric cancer cell SGC-7901 was obtained from the cell bank of the Chinese Academy of Sciences (Shanghai, China). All gastric cancer cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin. HMrSV5 cells was cultured in Roswell Park Memorial Institute-1640 (RPMI-1640) medium supplemented with 10% FBS, 100 U/ml penicillin G, and 100 μg/ml streptomycin sulfate. Cells were cultured at a 37 °C incubator with 5% CO2. Cells were used for less than 180 days after receipt or resuscitation from cryopreservation.

Tissue samples

Peritoneal metastatic lesions were obtained from patients who experienced a radical surgery of gastric cancer including resection of the peritoneum at the Department of Surgical Oncology, Ruijin Hospital. All GC patients provided informed consent to use their clinical and pathologic data. These experiments were approved by the Ethics Committee of Ruijin Hospital and executed in consistent with ethical principle of the World Medical Association Declaration of Helsinki.

Plasmids transfection and virus infection

The expression vector encoding CMV-C-3FLAG-Egr1 was designed and synthesized by Genechem Incorporation (Shanghai). Synthetic miR-181a-5p mimics and inhibitor, miR-124-3p mimics, miR-183-5p mimics, miR-191-5p mimics and the appropriate negative controls were obtained from Genepharma Incorportation (Shanghai). The lentiviral vector encoding pWPXL- FLAG-HOXA11 was constructed by Genepharma Incorportation (Shanghai). The HOXA11 shRNAs (GCCATTGAGCCCGCCACTAAA and GCAGTCTCGTCCAATTTCTAT) were synthesized and then subcloned into the vectors (PGMLV-hU6-MCS-Puro-WPRE), respectively (Genomeditech Incorportation, Shanghai). Crispr guide RNA (gRNA) sequence design, synthetization and lentiviral packaging were constructed by Genepharma Incorportation (Shanghai), the sequence of target Egr1-gRNA were as follows: Forward: 5’-CTGCAGATCTCTGACCCGTT-3’; Backward: 5’-GTTGCTGCCGCTGCCCTCTG-3’. Empty lentiviral vector worked as the control. The efficiency of transfection was examined by Western blotting and qRT-PCR to assess protein and mRNA expression following cell collection.

For plasmid transfections, HMrSV5 cells were grown at 70% confluence in 24-well plates and stably transfected with plasmids using Lipofectamine 2000 (Cat.11668-019, Invtrogen, USA), following the protocols. After incubation for 24 h, the culture medium was replaced with a fresh medium, and the transfected HMrSV5-Egr1+ and HMrSV5-Vector cells were harvested after treatment with 10 μg/ml puromycin (Beyotime Biotechnology, Shanghai) for two weeks. The efficiency of transfection was examined by Western blotting and qRT-PCR to assess protein and mRNA expression.

For the transfection of miRNA mimics and inhibitor, HMrSV5 cells were grown at 70% confluence in 24-well plates and transfected with RNA oligoribonucleotides using Lipofectamine 2000 (Cat.11668-019, Invtrogen, USA), following the protocols. The transfected HMrSV5 cells were collected for the following experiments after 48 h. The efficiency of transfection was examined using qRT-PCR to evaluate miRNA expression.

For virus infection, the GC cell lines NCI-N87 and SGC-7901 were infected with the lentiviral vectors for HOXA11 overexpression in the presence of 10 mg/ml Polybrene, MGC803 cells were infected with the lentiviral vectors for HOXA11 knockdown in the presence of 10 mg/ml Polybrene, and HMrSV5 cells were infected with the lentiviral vectors for Egr1 knockout in the presence of 10 mg/ml Polybrene. After incubation for 24 h, the culture medium was replaced with a fresh medium, and the infected cells were harvested after treatment with 10 μg/ml puromycin (Beyotime Biotechnology, Shanghai) for two weeks. The efficiency of infection was examined by Western blotting and qRT-PCR to assess protein and mRNA expression.

Western blotting

Total cell lysates were prepared using RIPA lysis buffer (New Cell & Molecular Biotech Co., Ltd, Soochow) containing phenylmethanesulfonyl fluoride (Beyotime Biotechnology, Shanghai) for 30 min on ice, and then the lysates were centrifuged at 16,000 × g, 4 °C for 10 min. Protein concentration was detected with Bio-Rad Protein Assay Kit (Bio-Rad) following the instructions. Lysates were separated by SDS-polyacrylamide gel electrophoresis followed by transferred onto a polyvinylidene difluoride membranes (Bio-Rad), and then membranes were blocked in 5% bovine serum albumin (BioShop) in TBST and probed with primary antibodies overnight in cold room. Secondary antibodies were incubated for 2 h at room temperature. The infrared imaging system (Tanon Life & Science Co., Ltd, Shanghai) and ECL substrate solution (Beyotime Biotechnology, Shanghai) were used for protein detection. The antibodies were listed in Table S1.

RNA extraction and quantitative real-time PCR (qRT-PCR) analysis

RNA was obtained from the indicated cells using TRIzol reagent method (Invitrogen). Aliquots of total RNA were reverse transcribed into Complementary DNA following protocols and followed by mixing with primers, SYBR Green PCR MIX (Applied Biosystems) and germ-free water. All reactions were executed in triplicate and executed on an ABI Prism 7900HT sequence detection system (Applied Biosystems). The level of target genes was normalized to that of GAPDH (internal control) according to the comparative Ct methods.

For miRNA detection, miRNA first strand cDNA synthesis was performed as protocols (Sangon Biotech Incorporation) and qRT-PCR was performed using microRNAs qPCR Kit (Sangon Biotech Incorporation). All the reactions were run for three times and executed on an ABI Prism 7900HT sequence detection system (Applied Biosystems). The forward primers of miRNA and U6 small nuclear RNA (U6) were designed and synthesized by Sangon Biotech Incorporation, the common reverse primer was obtained from the same company. The U6 small nuclear RNA (U6) was applied as internal control for miRNA assays, the threshold cycle values were calculated by the comparative Ct method [49]. The primers used for qRT-PCR were listed in Table S2.

Immunofluorescence staining and confocal scanning laser microscopy (CLSM)

The indicated HMrSV5 cells, NCI-N87-Vector cells and NCI-N87-HOXA11 cells co-cultured with HMrSV5 cells or alone were cultured on 8-well plates (Millipore, Mass, USA) and grew for 48 h. The cells were briefly washed with PBS, and then fixed in 4% formaldehyde for 30 min at room temperature, after fixation, the cells were washed with PBS (3 × 5 min) again, followed by permeabilizating with 0.1% Triton X-100 for 30 min and blocking using 5% BSA for 15 min. After that, the fixed cells or tissue sections were incubated with primary antibodies overnight at 4 °C atmosphere, and then incubated with species-specific secondary fluorescent antibodies in a light-proof environment for one hour at room temperature and DAPI was used to stain the nucleus in a light-proof environment at room temperature for ten min. Finally, the cells or tissue sections were washed with PBS (3 × 5 min), visualized, recorded, and analyzed using Carl Zeiss microscope, ZEN software (ZEISS Company) and Image J software (NIH, Md, USA). The antibodies were shown in Table S1.

The HMrSV5-Vector cells, HMrSV5-Egr1+ cells were cultured on 8-well plates (Millipore, Mass, USA) and grew for 48 h, respectively. The processes were as described above in the section of immunofluorescence staining. Confocal observation was performed using a Nikon Eclipse Ti (Nikon Solutions Co., Ltd, Tokyo, Japan) at excitation wavelengths of 405 nm (DAPI), 488 nm (FITC), and 561 nm (Cy3) and emission wavelengths of 417-477 nm (DAPI), 500–550 nm (FITC), and 570–1000 nm (Cy3). And the images were recorded and analyzed by Eclipse C2 (Nikon Solutions Co., Ltd, Tokyo, Japan) and Image J software (NIH, Md, USA). The antibodies were shown in Table S1.

Immunohistochemistry

Immunohistochemistry staining of paraffin slices of mice’ peritoneal tumor tissues and GC patient’s peritoneal metastatic lesions which were carried out on 4 μm-thick slices were identified to be tumor by hematoxylin and eosin (H&E) staining, and then performed using EnvisionTM Detection System (Dako, Agilent Technologies, Ca, USA) as protocols. When antigen retrieval was executed, the slices were incubated with the primary antibodies overnight at 4 °C, and then incubated with the horseradish peroxidase labeled secondary antibodies at 37 °C for 30 min and finally all slides were observed with diaminobenzidine. The intensity of positive staining was measured with integrated optical density. The antibodies were listed in Table S1.

Chromatin immunoprecipitation (ChIP)

ChIP assay was executed as protocols [1]. Briefly, SGC-7901 and NCI-N87 cells were collected in 15 ml tubes and fixed with 4 ml of 1% paraformaldehyde for 10 min at room temperature before being quenched with 1 ml of 1×glycine, respectively. Samples were rinsed with PBS twice and lysed with 1 ml of 1×lysis/wash buffer followed by sonicating to produce DNA fragments. After sonication, chromatin was pre-cleared and incubated with primary antibodies by rotation at 4°C overnight and then incubated with protein G agarose by rotation for additional 1 h. Immunoprecipitated DNA was eluted from the agarose and then DNA was reverse crosslinked by 5 M NaCl, RNase A, 0.5 M EDTA, 1 M Tris-HCL and Proteinase K and purification. DNA was obtained by phenol/chloroform extraction and ethanol precipitation. Primer sequences for ChIP-qPCR were listed in Table S2.

Co-immunoprecipitation assay (Co-IP)

Co-IP assay was executed as described previously [1]. Briefly, HMrSV5-Vector and HMrSV5-Egr1+ lysates were lysed with IP lysis/Wash buffer, respectively. And then the Aliquots of lysates were pre-cleared with control agarose resin slurry by rotation at 4 °C for 4 h, subsequently the lysates were immunoprecipitated using appropriate antibodies or corresponding IgG control by rotation at 4 °C overnight. The beads were washed with elution buffer and boiled for 5 min in the next morning, the bound proteins were resolved using SDS-PAGE, followed by western blotting with corresponding antibodies.

Luciferase reporter assay

Luciferase reporter assay about miRNA was executed as described previously [28]. Briefly, the amplified Egr1 3’UTR section and mutant section, which contained a substitution of six nucleotides (GAAUGU to CTTACA) within the miR-181a-5p binding site, were inserted into the pmiR-RB-REPORTTM vector and control vector (Genepharm, Shanghai), using the Xhol and NotI sites, respectively. Next, HMrSV5 cells were transfected with miR181a-5p mimics or miR-181a-5p inhibitor or vector, respectively. For the groups treated with co-cultured NCI-N87-HOXA11 cells or counterparts upon addition of neutralizing antibodies of PDGF BB and TGF β1 or BIBF. HMrSV5-Control cells or HMrSV5-miR-181a-5pi cells were treated with indicated concentration of neutralizing antibodies of PDGF BB and TGF β1 or BIBF for 24 h, meanwhile, NCI-N87-HOXA11 cells or counterparts were cultured into the upper compartments of the chamber with culture medium. After 48 h, the dual luciferase reporter system (Promega, USA) was applied to examined the luciferase activity.

Luciferase reporter assay about transcript factor was executed as described previously [1]. The wild type and truncating mutation of PDGF BB and TGF β1 were cloned into the pGL3-basic vector. the Smad luciferase reporter plasmid was designed and synthesized by YEASEN Incorporation (Shanghai). HMrSV5-Egr1+ cells, HMrSV5-Vector cells, HMrSV5-KoEgr1 cells and HMrSV5-Control cells were seeded in 24-well plate and co-transfected with Smad luciferase reporter plasmids and pRL-TK vector. For the groups treated with recombinant human PDGF BB or TGF β1 and neutralizing antibodies of PDGF BB or TGF β1, HMrSV5 cells were treated with indicated concentration of PDGF BB, TGF β1, neutralizing antibodies of PDGF BB or TGF β1 for 24 h. NCI-N87-HOXA11, NCI-N87-Vector, SGC-7901-HOXA11, SGC-7901-Vector, MGC803-Control, MGC803-shHOXA11#1 and MGC803-shHOXA11#2 cells were seeded in 24-well plate and co-transfected with the wild-type, truncating mutation PDGF BB or TGF β1 promoter luciferase reporter plasmids and pRL-TK vector. For the groups treated with recombinant human PDGF BB or TGF β1, NCI-N87 and SGC-7901 cells were added with indicated concentration of PDGF BB or TGF β1 for 24 h, and then cells were obtained and luciferase activity was illustrated using the Dual-Luciferase reporter assay system. The luciferase signal from the PDGF BB, TGF β1 and Smad reporters were normalized to the luciferase signal from the renilla reporter. Experiments were repeated in triplicated.

Transwell chemotaxis assay

Human peritoneal mesothelial cells recruitment was testified using a transwell assay. HMrSV5 -vector, HMrSV5-Egr1+ cells, HMrSV5-Control and HMrSV5-Egr1- (1 × 105 cells) were seeded on the lower compartment of 24-well plate and were separated from the upper compartment by a 10 μm thick poly-carbon membrane with 8.0 μm pores. NCI-N87-HOXA11, NCI-N87-Vector, SGC-7901-HOXA11, SGC-7901-Vector, MGC803-Control, MGC803-shHOXA11#1 and MGC803-shHOXA11#2 cells (1 × 105 cells) were placed on the upper compartment of the chamber with serum-free medium, respectively. After co-culturing for 24 h, chambers were washed using PBS buffer and GC cells were fixed in 1% paraformaldehyde and stained with 1% crystal violet. Non-migrated GC cells located at the upper chambers were cleared and washed using PBS buffer. Figures of five different location were captured. The ability of Human peritoneal mesothelial cells recruitment was evaluated by the number of migrated GC cells calculated per field respectively. Experiments were repeated in triplicated.

ELISA assay

PDGF BB and TGF β1 content in the cell culture supernatant was detected by a PDGF BB ELISA Kit (Beyotime Biotechnology, Shanghai) and TGF β1 ELISA Kit (Beyotime Biotechnology, Shanghai) as protocols. For the groups treated with recombinant human PDGF BB or TGF β1, NCI-N87-HOXA11, SGC-7901-HOXA11, MGC803-shHOXA11, or HMrSV5 cells were added with indicated concentration of PDGF BB or TGF β1 for 24 h and then the medium was replaced with serum-free medium for another 24 h, finally, the cell culture supernatant was collected and detected for the concentration of PDGF BB and TGF β1. Experiments were repeated in triplicated.

Gel contraction assay

Gel contraction assay was executed as described previously [50], briefly, HMrSV5-Egr1+, HMrSV5-Vector, HMrSV5-Control or HMrSV5-KoEgr1 cells (1 × 106 cells) and 500 μl collagen suspension were mixed and seeded in a 24-well plate. The collagen gel was maintained at a 37 °C incubators until it had been polymerized. And then 1 ml of culture medium wea located atop each collagen gel lattice and gels were gently separated from the sides of well using the sterile spatula. The gels were imaged at day=0 and set as 100% and subtracting the percentage area that remained at 96 h. Experiments were repeated in triplicated. For the groups treated with recombinant human PDGF BB or TGF β1, neutralizing antibodies of PDGF BB or TGF β1, or BIBF, HMrSV5 cells were treated with indicated concentration of PDGF BB, TGF β1, neutralizing antibodies of PDGF BB, TGF β1 or BIBF (10 μM) for 24 h. For the groups co-cultured with GC cells, NCI-N87-HOXA11, SGC-7901-HOXA11 cells, or counterparts (1 × 105 cells) were placed on the upper compartment of the chamber with culture medium and released from the lower compartment by a 10 μm thick poly-carbon membrane with 0.4 μm pores.

Cytokine microarray analysis

Cytokine microarray assay was executed as described previously [51], the human cytokine antibody array was designed and produced by RayBiotech Incorporation. Membranes were incubated with serum-free culture medium collected from NCI-N87-HOXA11, SGC-7901-HOXA11 cells, and counterparts and processed according to manufacturer’s protocol.

RNA-Sequencing analysis

HMrSV5 cells (1 × 105 cells) in 6-well plates were co-cultured with NCI-N87-HOXA11, SGC-7901-HOXA11, counterparts or none for 96 h, respectively. HMrSV5 Egr1+ and HMrSV5 -Vector cells (1 × 105 cells) were also seed in 6-well plates for 96 h. RNA was extracted from three biological replicates. RNA quality was examined by 2100 Bioanalyser (Agilent) and quantified using the ND-2000 (NanoDrop Technologies). All samples sent for library preparation and sequencing using the Illumina Hiseq4000 platform at Majorbio Biotech Co., Ltd. (Shanghai, China). Detection of circRNA, lncRNA and miRNA and analysis of different Gene expression were executed on the company’s cloud platform.

Mouse tumor models

Peritoneal metastatic xenograft model was executed as described previously [1]. Briefly, HMrSV5 cells, NCI-N87-Vector cells and NCI-N87-HOXA11 cells were lentivirally infected with firely luciferase (FFLuc) fusion vector (Genepharma) and selected with 10 μg/ml puromycin. And then HMrSV5-FFLuc cells (0.25 × 105 cells) and NCI-N87-Vector-FFLuc cells (1 × 105 cells) or HMrSV5-FFLuc cells (0.25×105 cells) and NCI-N87-HOXA11-FFLuc cells (1 × 105 cells) mixed within 0.1 ml PBS buffer were injected into the abdomen of mice, respectively. After 4 weeks, Bioluminescence imaging (BLI) of luciferase activity was applied to record tumor mass and distribution in abdomen of mice with a Xenogen IVIS system under 2.5% isoflurane anaesthesia. Pictures of mice was executed by injection of D-luciferin 10 min before BLI and bioluminescence in peritoneal foci were calculated using Spectrum Living Image Software. Finally, mice were anaesthetized and killed for tissue retrieval.

Animal studies were performed as protocols approved by Department of Experimental Animal Science, School of Medicine, Shanghai Jiao Tong University. Mouse housing, husbandry, and care practices reached the minimum requirements set forth in the Animal Welfare Act and the Guide for the Care and Use of Laboratory Animal.

Quantification and statistical analysis

Statistical analyses were calculated by statistical programming language R. The type and number of replicates, the statistical test used, and the test results were shown in the figure legends. An unpaired two-tailed Mann-Whitney U-test was performed for the comparison of two unpaired samples, and a two-tailed Student’s t-test was executed for the comparison of normally distributed parameters. ANOVA with Tukey’s post-test was applied for multiple comparisons which are grouped. Data were presented as mean and standard error unless specified otherwise. The level of significance in all graphs was shown as follows: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. No randomization or investigator blinding approaches were performed during the experiments and data analysis.