Remember me
ORIGINAL ARTICLE
Year : 2022 | Volume
: 18
| Issue : 9 | Page : 354-358
Analysis of SDC2 gene promoter methylation in whole blood for noninvasive early detection of colorectal cancer
Goli Siri1, Samira Alesaeidi2, Saeed Esmaeili Dizghandi3, Behrang Alani4, Meysam Mosallaei5, Mohsen Soosanabadi6
1 Department of Internal Medicine, Amiralam Hospital, Tehran University of Medical Sciences, Tehran, Iran
2 Department of Rheumatology and Internal Medicine, Rheumatology Research Center, Amir-Alam Hospital, Tehran University of Medical Sciences, Tehran, Iran
3 Department of Medical Genetics, Semnan University of Medical Sciences, Semnan, Iran
4 Department of Applied Cell Sciences, Faculty of Medicine, Kashan University of Medical Sciences, Kashan, Iran
5 School of Medicine, Aja University of Medical Science, Tehran; Department of Medical Genetics, Isfahan University of Medical Sciences, Isfahan, Iran
6 Department of Medical Genetics, Semnan University of Medical Sciences; Abnormal Uterine Bleeding Research Center, Semnan University of Medical Sciences, Semnan, Iran
Correspondence Address:
Mohsen Soosanabadi
Department of Medical Genetics, Semnan University of Medical Sciences, Semnan
Iran
Source of Support: None, Conflict of Interest: None
CheckDOI: 10.4103/jcrt.jcrt_1072_22
Objectives: Considering the limitations of the current approaches to colorectal cancer (CRC) screening, scientists strived to find noninvasive and more powerful biomarkers for the early diagnosis of CRC. Nowadays, there are different sources of biomarkers for CRC diagnosis. Blood-based samples including circulating cell-free tumor DNA (ctDNA) and DNA extracted from leukocytes in peripheral blood might be promising sources of noninvasive cancer biomarkers such as cancer-specific methylation patterns. In this study, we aimed to evaluate the noninvasive early diagnosis of CRC via quantitative promotor methylation analysis of SDC2 gene in whole blood.
Materials and Methods: Sixty-five CRC patients and 65 healthy participants were enrolled to assess promoter methylation of SDC2 gene in whole blood using the methylation quantification endonuclease-resistant DNA (MethyQESD) technique.
Results: Our findings demonstrated drastic hypermethylation of SDC2 in blood samples from CRC subjects (37.91%) compared with non-malignant individuals (17.02%) (P < 0.001). The sensitivity for detection of CRC by methylation of SDC2 was 81.54%, with a specificity of 69.23%. The ROC curve analysis demonstrated that the AUC was 0.847 (P < 0.001), indicating that the status of SDC2 promoter methylation in whole blood is an excellent biomarker of CRC diagnosis. Furthermore, our results showed that methylation level in CRC patients significantly increased in higher tumor stages, demonstrating that an increased percentage of methylation is correlated with tumor progression (P < 0.001).
Conclusion: SDC2 promoter methylation status in blood samples is a valuable cancer biomarker and holds high power and accuracy in distinguishing CRC patients from healthy subjects in the early stages of the disease.
Keywords: Biomarker, colorectal cancer, methylation, SDC2 gene
Based on GLOBOCAN 2020 data, it is estimated that 1.9 million new colorectal cancer (CRC) cases were diagnosed and CRC caused 0.9 million deaths worldwide, making CRC the third most common cancer worldwide.[1],[2] CRC is known as a silent tumor because most CRC tumors start from a non-cancerous polyp, i.e., a benign growth on the mucosal surface, which, in a period of 5–15 years, can develop into cancer.[3],[4] Screening and early diagnosis of CRC can dramatically reduce disease-related mortality.[5] Conventional methods for CRC screening and diagnosis include fecal occult blood test (FOBT), flexible sigmoidoscopy, and colonoscopy. However, these methods have some limitations, such as low sensitivity and specificity and its invasive nature.[6],[7] Therefore, finding sensitive, specific, and noninvasive biomarkers is of paramount importance and highly needed for early CRC diagnosis. Convincing evidence has confirmed that both genetic and epigenetic changes are involved in tumorigenesis and the development of CRC.[8] In this context, studies have revealed that epigenetic alterations play critical roles in various aspects of colorectal carcinogenesis.[9] In this direction, in the past decades, altered DNA methylation, histone modifications, and dysregulated expression of long non-coding RNAs (lncRNAs) and microRNAs (miRNAs) have been shown as promising biomarkers in CRC diagnosis and prognostication.[10],[11] One of the interesting biomarkers in different types of cancers, especially in CRC, is promoter DNA methylation that occurs on CpG islands which are mostly correlated with, respectively, hypomethylation or hypermethylation of oncogenes and tumor suppressor genes, two fundamental players in cancer initiation and progression.[12],[13] Currently, there are different sources of biomarkers for CRC diagnosis including tumor tissue, blood, urine, and fecal.[14] Blood-based CRC screening strategy that is highly accepted by patients has the potential as an available source for different types of biomarkers. These sources consist of whole blood containing the plasma and cellular components such as red blood cells (RBCs) and white blood cells (WBCs), plasma itself, and serum.
Syndecan-2 (SDC2) promoter methylation is a feasible biomarker for CRC detection. SDC2 is a cell surface proteoglycan that bears heparan sulfate and has been shown to have oncogenic or tumor-suppressive roles in different types of malignancies.[15–17] Most previous studies evaluated the promoter methylation status of this gene in fecal and plasma samples and introduced SDC2 promoter methylation as a promising biomarker with high sensitivity and specificity for CRC diagnosis.[18–23]
In the present study, we intended to evaluate the ability of SDC2 promoter methylation in whole blood samples for the early diagnosis of CRC. To assess methylation quantitatively, the methylation quantification endonuclease-resistant DNA (MethyQESD) was recruited as a robust quantitative methylation analysis technique.[24]
> Materials and MethodSample collection
One hundred and thirty peripheral blood samples were collected from 65 subjects with CRC, who were diagnosed via colonoscopy followed by confirming pathology reports, and 65 healthy participants as a control group without any history of familial cancer and negative colonoscopy results for CRC. The experimental design was confirmed by the Semnan University of Medical Sciences with approval number IR.SEMUMS.REC.1400.177, and informed consent was obtained from each subject in case and control groups. The demographic characteristics and body mass index (BMI) and tumor stage were achieved based on a structured questionnaire and pathological reports. Subsequently, 2.5 mL of peripheral blood was drawn from each subject using an EDTA tube and stored at −20°C for further processing.
DNA extraction and quantitative methylation analysis
DNA was extracted from 200 μL of EDTA anticoagulated whole blood samples using the Prime Prep Genomic DNA Isolation Kit (GeNetBio, Korea). DNA yield and purity were assessed using methods such as absorbance (spectrophotometry) and agarose gel electrophoresis, respectively.
Quantitative methylation analysis was performed using MethyQESD which was a combination of methylation-sensitive digestion and real-time polymerase chain reaction (PCR). The proportion of methylated DNA that resists digestion by the methylation-sensitive endonuclease Hin6I is determined by real-time PCR and is calibrated using a reference DNA that remains uncut (using XbaI and DraI which digest total DNA except for our target in the promoter sequence). MethyQESD was described in detail by Bettstetter et al. for the first time and also was employed in our previous study.[24],[25] A real-time PCR was performed in a final volume of 10 μL containing digested DNA (1 μL), 1 μL of primers, and 5 μL of 2 × SYBR Green PCR Master Mix (Thermo Fisher). The forward and reverse primer sequences for the 167 bp fragment around the promoter sequence of the SDC2 gene were GGAGGAGAAGGAGGAGGACC and TACGGCAGAAGTTTAGGGGC, respectively. The cycling profile started with five minutes of initial denaturation at 95°C, then 40 cycles of amplification at 95°C for twenty seconds, 59°C for thirty seconds, and 72°C for thirty seconds were used.
Statistics
The statistical analyses to estimate the methylation status of SDC2 gene promoter in CRC and control groups were performed by Statistical Package for the Social Sciences (SPSS) version 25 (Armonk, NY: IBM Corp). Also, the receiver operating characteristic (ROC) curve was constructed to quantify the diagnostic utility of SDC2 promoter methylation level by measuring its sensitivity, specificity, and respective areas under the curve (AUCs). P values were calculated via independent t, Chi-squared, or ANOVA tests. The significance level was set at P < 0.05.
> ResultsSubject characteristics
In the present study, the CRC group consisted of 38 males and 27 females with a mean age of 55.93 ± 11.79 and a mean BMI of 25 ± 3.87. The control group consisted of 31 males and 34 females with a mean age and BMI of 54.24 ± 9.10 and 24.90 ± 3.43, respectively. There were no substantial differences between the patients and healthy individuals with respect to the mean age (P = 0.362) and sex (P = 0.292), representing that for these factors matching was satisfactory. According to pathological findings, 19, 24, 13, and 9 CRC cases were classified as patients in stages I, II, III, and IV, respectively. Features of the CRC patients and non-malignant control group are listed in [Table 1].
Table 1: Characteristics of CRC patients and healthy controls in this studySDC2 promoter methylation status
Our examination demonstrated that the mean SDC2 promoter methylation level in the CRC and control groups were 37.91% and 17.02%, respectively. The difference in the average methylation level between CRC patients and healthy control participants was substantial (P < 0.001). The promoter methylation levels between the case and the healthy control groups are compared in [Figure 1]. [Table 2] demonstrates that the mean percentage of SDC2 promoter methylation was statistically significantly different (P < 0.001) in distinct stages of the disease as follows: 27.86%, 32.02%, 50.00%, and 57.34% for patients in stages I, II, III and IV, respectively.
Figure 1: Comparison of SDC2 promoter methylation level between patients with CRC and healthy controls. P < 0.001*
Table 2: The percentages of methylation in case and control groups and their diagnostic value.The appropriate cutoff point for SDC2 promoter methylation level to differentiate between CRC and non-malignant subjects was set at ≤20%. Hence, the sensitivity and specificity were considered as 81.54% and 69.23%, respectively. The ROC curve analysis demonstrated that the AUC was 0.847 (P < 0.001), meaning that the utility of SDC2 promoter methylation in a whole blood sample can be regarded as an excellent biomarker [Figure 2].
Figure 2: The receiver operating characteristic (ROC) curves of SDC2 promoter methylation level in patients with CRC compared with healthy controls. Area under the curve (AUC) = 0.847; P < 0.001* > Discussion Screening has a central role in the control of CRC and is effective in reducing CRC-associated mortality. Although FOBT as the currently available screening method for CRC screening is a noninvasive test, there are some limitations such as low sensitivity for polyps, low sensitivity for detection of tumors that are located in the distal colon, a relatively low specificity, and false- positive screens, making repetition of screening necessary.[26],[27] On the other hand, colonoscopy is regarded as the gold standard test for CRC diagnosis with high sensitivity and specificity. However, there is low compliance for screening colonoscopy by patients because of its invasive nature, needing to follow a restricted diet, and the risk of colon injury during the procedure.[28],[29] Considering these drawbacks, researchers look for new and alternative approaches in readily available and noninvasive sources such as blood, urine, or stool. A novel approach is the usage of cancer biomarkers that are present just in a person with cancer.
With the improvement of a different novel class of noninvasive biomarkers, especially nucleic acid biomarkers, the early detection of CRC patients has been more successful. Nucleic acid-associated biomarkers comprise DNA mutation and epigenetic alteration which can be detected from circulating cell-free tumor DNA (ctDNA), mRNAs, miRNAs, and lncRNAs.[4],[30],[31]
Abnormal methylation of CpG-rich sequences has been detected in almost every human cancer, especially in CRC. Altered patterns of DNA methylation, through promoter hypermethylation, can eventually cause genetic instability and cancer progression via the inactivation of some critical genes which are called tumor suppressor genes. ctDNA is easily accessible in peripheral blood and can be used for tracking methylation dysregulation for early cancer detection.[32],[33]
ctDNA and DNA extracted from blood-based samples such as leukocytes in peripheral blood might be a promising source of noninvasive cancer biomarkers. Whole blood sample including the liquid fragment of ctDNA, which was routinely used in previous studies, and genomic DNA (gDNA), that is mostly extracted from leukocytes, may be a potential source of cancer biomarkers. Recently, it has been revealed that leukocytes can mimic the bio-status of tissues that they are in contact with, such as tumor cells.[34–36]
In the present study, for the first time, we assessed the ability of promoter methylation status of the SDC2 gene in the whole blood sample to be used as a diagnostic biomarker for early detection of CRC. Our findings demonstrated that the average methylation of SDC2 in colorectal cancer is significantly different compared to control samples. Interpretations of the ROC-AUC suggested that the quantitative methylation analysis of SDC2 is an excellent approach for discrimination between subjects with CRC tumors and healthy individuals (AUC = 0.847) [Figure 2]. Furthermore, our results showed that the methylation level in CRC patients increased with higher tumor stages, demonstrating that an increased percentage of methylation is correlated with tumor progression [Table 2].
Mitchell et al. reported that the methylation level of this gene is significantly different in peripheral blood samples between CRC patients and healthy donors.[37] On the other hand, another study that evaluated the methylation level of SDC2 only in leukocytes reported no significant difference between CRC and healthy controls.[38] This contrast can be attributed to different sample types (whole blood sample compared with only leukocytes), different promoter sequences that were analyzed, and different methods for methylation analysis. Some studies proposed the evaluation of SDC2 methylation in plasma samples as a potent biomarker for CRC diagnosis. For example, three different studies have shown that a combination of SDC2 and SFRP2 methylation have a sensitivity between 76% and 91% and specificity between 87% and 97% for CRC diagnosis.[22],[23],[39] Most previous studies evaluated the ability of SDC2 promoter methylation analysis in the diagnosis of CRC in a stool sample and revealed satisfying sensitivity and specificity for CRC detection.[19],[20],[40],[41],[42],[43] In contrast with our results, no research on stool samples showed an increased level of SDC2 methylation in higher tumor stages. This contrast can be attributed to different sample types because in our study, we evaluated methylation levels indirectly from whole blood (mainly through leukocytes), but studies on stool samples directly assessed methylation levels in ctDNA.
In conclusion, given the satisfactory sensitivity and specificity of this marker, we unveiled that SDC2 promoter methylation status in the whole blood sample is a promising cancer biomarker and holds high power and accuracy in distinguishing CRC patients from healthy subjects in the early stages of the disease. There are probably some limitations in the present study in terms of the statistical validity of our findings because of its small sample size and the number of genes investigated. Hence, additional comparable studies with bigger sample sizes and multiple genes are essential to authorize the recommended discoveries.
Authors' contributions
All authors were involved in whole work.
Acknowledgements
We would like to appreciate any support provided by Semnan University of Medical Sciences.
Declaration of patient consent
The authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
> References
Comments (0)