Cell lines

293T cells, Jurkat cell line, and Daudi cell line were purchased from ATCC. 293T were cultured with IMDM (Gibco) supplemented with 10% FBS (Sigma), 2 mM GlutaMax (Gibco), penicillin (100 units/mL; Gibco) and streptomycin (100 µg/mL; Gibco). Jurkat cells and Daudi cells were cultured with RPMI-1640 (Gibco) supplemented with 10% FBS (Sigma), 2 mM GlutaMax (Gibco), penicillin (100 units/mL; Gibco) and streptomycin (100 µg/mL; Gibco). All cells were cultured at 37 °C with 5% CO2. All the cell lines were validated for the absence of mycoplasma.

Plasmid construction and production of retroviral supernatants

All retroviral vectors were generated using the SFG backbone. All CARs were generated using the single-chain variable fragment (scFv) from specific antibodies (FMC63 scFv for CD19-specific CAR, 14G2a scFv for GD2-specific CAR, and 376.96 scFv for B7-H3-specific CAR), the CD8α stalk and transmembrane domain, the CD28 or 4-1BB intracellular domains, and CD3ζ intracellular domain (ζ-chain) as previously described [15,16,17]. GFP-tagged CARs were generated as previously described [14]. The 19.CD28ζ shGFP, 19.BBζ shGFP, 19.CD28ζ shA20, and 19.BBζ shA20 plasmids were constructed by inserting specific shRNAs targeting GFP or A20 into the 19.CD28ζ or 19.BBζ backbone using the U6 promoter sequence. The 19.CD28 CD3ζ and 19.BB CD3ζ mutants were generated by mutating PYAPP to AYAAA within the ζ-chain sequence. The 19.BBζ mut1, mut2, and ΔC10 plasmids contain mutations of 4-1BB that remove either the TRAF2 binding site (BBζ mut1, QEED→QAAA), or the TRAF1/2/3 binding sites (BBζ mut2, PEEEE→PEAAA), or delete the last 10 amino acids of the carboxyl-terminal tail (BBζ ΔC10) [8]. Retroviral supernatants were prepared as previously described [16, 63]. Briefly, 293 T cells were transfected with the three-plasmids-system including two plasmids encoding Peg-Pam-e/gag-pol and the RD114 envelope using the GeneJuice transfection reagent (Novagen). Supernatants were collected and filtered after 48 and 72 h.

Generation of CAR-T cells

Buffy coats from healthy donors were obtained through the Gulf Coast Regional Blood Center (Houston, TX). Peripheral blood mononuclear cells (PBMCs) were isolated with Lymphoprep density separation (Fresenius Kabi Norge) and activated using plates coated with 1 mg/mL anti-CD3 (Miltenyi Biotechnology) and 1 mg/mL anti-CD28 (BD Biosciences) Abs. Forty-eight hours later, T lymphocytes were transduced with retroviral supernatants using retronectin-coated plates (Takara Bio) and expanded in complete medium including 45% RPMI-1640, 45% Click’s medium (Irvine Scientific), 10% FBS (Hyclone), 2 mM GlutaMAX (Gibco), 100 units/mL penicillin (Gibco) and 100 mg/mL streptomycin (Gibco). Cells were fed with IL-7 (10 ng/mL; PeproTech) and IL-15 (5 ng/mL; PeproTech). CAR-T cells were expanded in vitro for 7–10 days as per clinical manufacturing of CAR-T cells [64, 65]. The formation of CAR-T cell aggregates was observed under randomly selected fields by a bright-field microscope (Olympus), and the size was calculated using Fiji software.

Flow cytometry

CAR expression in T cells was detected as previously described [16, 17, 66]. Human anti-CD3(#560167), CD19(#340364), CD20(#340941), Annexin-V(#556421), and 7-AAD(#559925), Granzyme B(#561142), IFNγ(#563731) Abs were obtained from BD Biosciences. Human anti-p-p65(#3033), cleaved caspase-8(#9496), cleaved caspase-3(#9602), RIPK3(#10188), and p-MLKL(#91689) Abs were obtained from Cell Signaling Technology and were used to stain cells after fixation and permeabilization (BD Biosciences). Chicken anti-Rabbit IgG conjugated with AF594(#A-21442) was obtained from Invitrogen. Cell Trace Violet (#C34557) was purchased from Thermo Scientific. Human anti-ICAM-1 Ab (#353106) and Zombie Aqua™ (#423102) dye were purchased from BioLegend. Counting beads (Invitrogen) were used to count the cells. Samples were acquired on a Canto II or Fortessa flow cytometer from BD, and data were analyzed using the FlowJo software. Necrostatin-1 (Nec-1) was purchased from Medchemexpress (MCE). DMSO was used to dissolve the inhibitors. CAR-T cells were incubated with DMSO or inhibitors for 24 h, followed by flow cytometry analysis after Annexin-V staining.

Activation of CAR.CD19-T cells with the anti-idiotype Ab

The activation of CAR-T cells was conducted according to our previous report [8]. Briefly, non-tissue culture-treated 24-well plates were coated with the anti-CAR.CD19 Ab (1 μg/ml, 233-4A) overnight. Plates were washed twice before plating T cells (1 × 106 cells/well). Plates were centrifuged at 1000 g for 5 min, and incubated at 37 °C for 24 h.

ICAM-1 blocking assay

CAR-T cells were treated with 0.5 mg/ml anti-ICAM-1 Ab (#353102, BioLegend) or PBS control for 4 days. The Ab was added every two days. Cell cluster formation and phenotypic characterization were performed on day 8 of culture.

Confocal microscopy

T cells expressing the CAR fused with GFP were fixed and permeabilized with the Cytofix/Cytoperm buffer (BD Biosciences), stained with DAPI (Invitrogen), washed with PBS, and mounted on glass-bottom microwell dishes (MatTek corporation). For the colocalization analysis, CAR-T cells without GFP fusion were stained with goat-anti-mouse FITC secondary Ab (BD bioscience), followed by fixation, permeabilization, and staining with AF647-conjugated human anti-A20 Ab (sc-166692 AF647, Santa Cruz Biotechnology) and DAPI. Data acquisition was performed on an LSM700 Zeiss laser scanning confocal microscope (objective lens 63×/1.4 Plan Apo Oil, pixel size 0.07 μm, pinhole size 1 AU) using ZEN software (ZEISS Microscopy). All images were acquired using the same settings. Data analyses including fluorescence intensity and Pearson correlation coefficient were performed with the Fiji software.

Coculture experiments and ELISAs

CAR expression was examined before coculture experiments to normalize the CAR-T cell numbers. Daudi cells (i.e. target cells, 2 × 105 cells/well) were seeded into 24-well plates and T cells were added at effector to target (E:T) ratio of 1:5. After 24 h, supernatants were collected for examining cytokines IFNγ and IL-2 by enzyme-linked immunosorbent assay (ELISA) following manufacturer’s instructions (R&D Systems). ELISA data were collected and analyzed using the Lumina-200 System. Five days after coculture initiation, cells were collected and stained with Zombie followed by anti-human CD3 and CD20 Abs for flow cytometry analysis. To assess the spontaneous secretion of cytokines, control T cells and CAR-T cells (1 × 106 cells/well) were starved for 1 day in 2 mL complete medium without IL-7 and IL-15. Spontaneous secretion of cytokines including IFNγ and IL-2 was detected in the culture supernatants by ELISA.

Immunoprecipitation

The immunoprecipitation (IP) of CAR-T cells was conducted as previously described [8]. Total proteins obtained from T cells (at least 5 × 107 cells) were extracted using RIPA lysis buffer (Thermo Scientific) supplemented with protease/phosphatase inhibitors cocktails (Thermo Scientific). Equal amounts of total proteins were used for IP and input (whole cell lysate). IP samples were pre-cleared using rabbit/mouse IgG (Thermo Scientific) with protein G magnetic beads (Bio-Rad). Anti-idiotype CAR.CD19 Ab (1:100), anti-4-1BB (1:50, #34594, Cell Signaling Technology), or anti-A20 (1:100, #5630, Cell Signaling Technology) Abs were incubated with the IP samples for 16 h, and protein G beads were then used for the pull-down by magnetic separation. RIPA buffer was used to wash the IP products at least three times. IP products and input were both dissolved in SDS Laemmli buffer (Bio-Rad) supplemented with β-mercaptoethanol for Western blot analysis.

Mass spectrometry

The mass spectrometry (MS) analysis was performed as previously described [8]. Briefly, IP samples from control and CAR-expressing Jurkat cells and two human CAR-T cell products were subjected to SDS polyacrylamide gel electrophoresis (SDS-PAGE, Bio-Rad) and stained with Coomassie Brilliant Blue (Bio-Rad). Proteins were reduced, alkylated, and in-gel digested with trypsin overnight at 37 °C. Peptides were extracted, desalted, and dried via vacuum centrifugation. The peptide samples were analyzed by liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) in 3 separated experiments by Thermo Easy nLC 1000 coupled to a QExactive HF or a Waters nanoAcquity coupled to a Thermo LTQ-Orbitrap Velos. Samples were injected onto a PepMap C18 column (75 μm inner diameter ×25 cm, 2 μm particle size) (Thermo Scientific) and separated over a 120 min gradient where mobile phase A was 0.1% formic acid in water and mobile phase B consisted of 0.1% formic acid in ACN. The LTQ-Orbitrap Velos was operated in data-dependent mode where the 10 most abundant precursors were selected for CID fragmentation (35% CE). The QExactive HF was operated in data-dependent mode where the 15 most intense precursors were selected for subsequent HCD fragmentation (27 NCE). Proteome Discoverer (version 2.1, Thermo Scientific) was used to process all raw data, which was searched against a Uniprot human database using Sequest. Data were filtered by a peptide cutoff of 5% false discovery rate (FDR). Spectral counts were used for protein quantification.

Western blot

Protein lysates obtained from control and CAR-T cells were resolved on 4–15% SDS-PAGE. Proteins were transferred onto polyvinylidene fluoride membranes (Bio-Rad). Membranes were blocked in 5% non-fat milk (Bio-Rad) or 5% bovine serum albumin (BSA, VWR Life Science) in TBS-T and incubated with primary and secondary Abs. The following Abs were used: anti-CD3ζ (1:1000, sc-1239, Santa Cruz Biotechnology), anti-β-actin (1:2000, sc-47778, Santa Cruz Biotechnology), anti-GAPDH (1:2000, sc-47724, Santa Cruz Biotechnology), anti-A20 (1:1000, #5630, Cell Signaling Technology), anti-p-A20 (Ser381, 1:1000, #63523, Cell Signaling Technology), anti-p-IKKα/β (Ser176/180, 1:1000, #2697, Cell Signaling Technology), anti-p-p65 (Ser536, 1:1000, #3033, Cell Signaling Technology), anti-IKKβ (1:1000, #8943, Cell Signaling Technology), anti-p-RIPK1 (Ser166, 1:1000, #65746, Cell Signaling Technology), anti-RIPK1 (1:1000, #3493, Cell Signaling Technology), anti-p-RIPK3 (Ser227, 1:1000, Abcam, ab209384), anti-RIPK3 (1:1000, #2283 ProSci), anti-p-MLKL (Ser358, 1:1000, #91689, Cell Signaling Technology), anti-MLKL (1:1000, #14993, Cell Signaling Technology), anti-cleaved caspase-8 (Asp374, 1:1000, #9496, Cell Signaling Technology), anti-4-1BB (1:1000, #34594, Cell Signaling Technology), and horseradish peroxidase conjugated secondary Abs (goat-anti-mouse and goat-anti-Rabbit both from Thermo Scientific). Membranes were developed with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific) on a Gel station (Bio-Rad).

Quantitative RT-PCR

RNA was extracted using RNeasy Kit (QIAGEN), followed by reverse transcription to cDNA using Superscript VILO (Invitrogen). Human A20 primers were as follows: Forward: TCCTCAGGCTTTGTATTTGAGC; Reverse: TGTGTATCGGTGCATGGTTTTA. The PowerUp SYBR Green Master Mix (Applied Biosystems) was applied to perform qRT-PCR using the QuantStudio 6 PCR machine (Applied Biosystems) per the manufacturer’s protocol. The 18S ribosomal RNA was used as a housekeeping gene (GENEWIZ). Data were analyzed using the 2−ΔΔCT method.

NF-κB luciferase reporter assay

The NF-κB luciferase reporter assay was conducted to test the transcriptional activity of NF-κB signaling. Briefly, control and CAR-T cells were transduced with the NlucP/NF-κB-RE/Hygro Vector (Promega) at days 3–5 of culture. After incubation for 72 h, T cells were harvested to record the luciferase reporter activity using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s protocol.

CAR-T cell proliferation assay

The anti-idiotype CAR.CD19 Ab (1 μg/ml) was used to pre-coated 24-well plates [31]. Control and CAR-T cells (1 × 106 cells) were starved for 1 day, labeled with CTV, and cultured in 1 mL complete medium without IL-7 and IL-15. CTV signal dilution was measured using flow cytometry on day 1 and day 5 gating on T cells.

In vitro ubiquitination assay

The ubiquitination assay was performed as previously described [35]. Briefly, CAR-expressing Jurkat cells were transduced with a 6His-Flag ubiquitin construct (6HF-Ub), seeded in 15 cm dishes, and grown until reaching 90% confluence. Cells were then washed and harvested in PBS. Of the cell suspension, 80% was lysed in 6 M Guanidine-HCl-containing buffer, sonicated, and filtered, which was used to pull down endogenous proteins conjugated to the 6HF-Ub on Ni2+ - nitrilotriacetic acid (NTA) beads. After that, beads were washed thoroughly, and the precipitated proteins were eluted using imidazole. The remaining 20% of cell suspension was pelleted and solubilized using a detergent-containing buffer supplemented with protease inhibitors to prepare inputs. Both pull-down eluates and inputs were separated by SDS-PAGE and analyzed by Western blot.

RNA sequence and bioinformatics analysis

CAR-T cells on day 7 of culture were activated using the anti-CD19 anti-idiotype Ab and collected for RNA sequencing after 24 h. CAR-T cells non-stimulated were used as control. Total RNA was isolated using RNeasy Mini kits (QIAGEN) following the manufacturer’s instructions. The quality of total RNA was evaluated using RNA 6000 Nano LabChip (Agilent 2100 Bioanalyzer, Santa Clara, CA). All samples had intact 18S and 28S ribosomal RNA bands with RIN numbers from 8.1 to 10 and RNA 260/280 ratios between 1.9 and 2.0. Raw data were processed with SOAPnuke, Bowtie, and RSEM. The differentially expressed genes (DEGs) were identified using DEseq2 algorithms and visualized with the ggplot2 package in R. Additionally, microarray and RNA sequencing datasets were downloaded from GEO for pathway enrichment. The enrichment of KEGG pathways of DEGs comparing CD28 and 4-1BB costimulated CAR-T cells was conducted using the ClusterProfiler R package. Plots including bar plots, Venn plots, and volcano plots according to the DEGs were visualized by ggplot2 R package. Clustering analysis was performed using the ComplexHeatmap R package.

In vivo mouse model

Male or female NSG (NOD-scid IL2Rgnull) mice were injected intravenously (i.v.) with CD19+ Daudi tumor cells labeled with Firefly luciferase (2 × 106 cells) and treated at day 4 with a suboptimal dose of CAR-T cells (2 × 106). Tumor growth was monitored twice a week. On day 21 or endpoint time, blood or spleen was collected for immunophenotyping to detect CAR-T cells. For testing the T cell infiltration, on day 7, spleen and bone marrow were collected to detect CAR-T cells by immunophenotype. All animal experiments were performed in accordance with UNC Animal Husbandry and Institutional Animal Care and Use Committee (IACUC) guidelines and were approved by UNC IACUC.

Statistical analysis

Data were summarized as the mean ± SD. The student t-test, one-way ANOVA, or two-way ANOVA were used to determine statistical significance between groups. Paired t-test was conducted to analyze the coculture assay of A20 overexpression. Multiple comparisons were used to calculate the adjusted p-value when appropriate. p < 0.05 was considered statistically significant. ns represented no significance. All statistical analyses were performed using GraphPad Prism 8 (GraphPad Software, CA).