Animals

The Model Animal Research Center of Shandong University (Jinan, China) supplied forty male C57BL/6 J mice aged four weeks for this study. The mice were fed in a standard environment at 22–25 °C with 55%±5% humidity and a cycle of light and dark lasting for 12 h. Following two weeks of normal chow diet feeding, the mice were equally divided into the normal chow diet (control) and HFD (Jiangsu Xietong Corporation, Nanjing, China, Table S1. Compositions of experimental diets) groups. Following 12 weeks of uninterrupted feeding, the HFD-fed mice were administered STZ by intraperitoneal injection to establish the mouse model of MAFLD. After fasting glucose ≥ 16.7 mmol/L was measured twice, modeling success was assessed. The control mice were separated into two groups: Control + Vehicle (n = 8) and Control + Puerarin (n = 8). The MAFLD mice were separated into two groups: MAFLD + Vehicle (n = 8) and MAFLD + Puerarin (n = 8). Puerarin (200 mg/kg BW, CAS No: 3681-99-0, MedChemExpress) was prepared in a vehicle (sodium carboxymethylcellulose) and administered by gavage. The treatment frequency was three times per week (Monday, Wednesday, and Friday). The Control + Vehicle group and MAFLD + Vehicle group were given an equal volume of vehicle without puerarin. Body weights were examined weekly, and after four weeks, the mice were subjected to the intraperitoneal glucose tolerance test (IPGTT) and intraperitoneal insulin tolerance test (IPITT), at the end of which the mice were anesthetized and sacrificed to collect blood and liver samples.

Metabolic index detection

The mice were given a glucose injection intraperitoneally to perform the IPGTT after 12–16 h of fasting and were administered insulin to perform the IPITT following 4–6 h of fasting. The IPGTT and IPITT were performed by collecting blood from the tail vein tip at 0 min and 30, 60, 90, 120, 150, and 180 min after administration to determine the glucose level. ELISA kits (Nanjing, Jiancheng) were used to measure aspartate triglyceride (TG), total cholesterol (TC), aminotransferase (AST), and alanine aminotransferase (ALT) levels in the blood serum. Catalase (CAT) was measured by visible light method, malondialdehyde (MDA) was measured by thiobarbituric acid method, glutathione peroxidase (GSH-PX) was measured by colorimetric method, and total superoxide dismutase (T-SOD) was determined by hydroxylamine method in the homogenate of liver tissue using reagent kits (Nanjing, Jiancheng), complying with the manufacturer’s guidelines.

Cell culture

The alpha mouse liver 12 (AML12) cell line was procured from Shanghai Cell Bank, cultured in DMEM/F12 medium (Gibco, USA) containing 10% fetal bovine serum, 100 U/mL penicillin, 100 μg/mL streptomycin, 1% insulin-transferrin-selenium, and 0.1 μmol/L dexamethasone, and then placed in an incubator at 37 °C with 5% CO2. The MAFLD cell model was established using 0.4 mM PA to stimulate AML12 cells for 48 h in the presence of puerarin. The cells were pretreated with EX-527 (a SIRT1 inhibitor, CAS. No. 49843-98-3, MedChemExpress) and Nrf2 siRNA. The siRNA sequences were provided by GenePharma. The Nrf2 siRNA sequences were as follows: sense 5′-GGAGGCAAGACAUAGAUCUTT-3′ and antisense 5′-AGAUCUAUGUCUUGCCUCCTT-3′. The negative control sequences were as follows: sense 5′-UUCUCCGAACGUGUCACGUTT-3′; antisense 5′-ACGUGACACGUUCGGAGAATT-3′. AML12 cells were transfected with siRNA by using Lipofectamine 3000 according to the manufacturer’s guidelines.

Western blot analysis

Radioimmunoprecipitation assay (RIPA) lysis buffer was used to lyse AML12 cells and liver tissue. A BCA assay kit (Beyotime, China, CAS. No. P0012S) was used to determine protein concentrations, after which the proteins were separated on sodium dodecyl sulfate‒polyacrylamide gels and transferred to polyvinylidene difluoride (PVDF) membranes (R1PB86935, 0.22 μm, Millipore, USA). The PVDF membranes were incubated with 5% skim milk for 1 h at room temperature, after which the membranes were incubated with specific primary antibodies at 4 °C overnight. The following day, horseradish peroxidase-conjugated secondary antibodies were added and incubated with the membranes for 1 h at room temperature. Enhanced chemiluminescence was used to display the protein bands and quantify them using ImageJ software, and β-actin was used as a standard. The specific primary antibodies were as follows: SIRT1 (1:1000, Abcam, USA, Cat. No. ab189494), p-Nrf2 (Ser 40) (1:1000, Affinity, China, Cat. No. DF7519), Nrf2 (1:1000, CST, USA, Cat. No. 12,721), HO-1 (1:1000, ABclonal, China, Cat. No. A1346), SLC7A11 (1:1000, ABclonal, China, Cat. No. A2413), GPX4 (1:1000, Abcam, USA, Cat. No. ab125066), phospho-NF-κB p65 (1:1000, CST, USA, Cat. No. 3033T), NF-κB p65 (1:1000, CST, USA, Cat. No. 8242T), TNF-α (1:1000, Bioss, China, Cat. No. bs-2081R), IL-1β (1:100, Abcam, USA, Cat. No. ab283818), IL-6 (1:100, Abcam, USA, Cat. No. ab290735), and β-actin (1:1000, Abways, China, Cat. No. Ab0035).

Coimmunoprecipitation assay

AML12 cells were seeded in 6 cm Petri dishes, and the cells were harvested and lysed on ice with immunoprecipitation lysis buffer, followed by centrifugation at 4 °C for 10 min at 13,000 g. The supernatant was collected and incubated with rabbit IgG or primary antibodies overnight at 4 °C. The following day, preequilibrated magnetic beads were added and incubated at room temperature for 1 h. Then, the beads were rinsed four times with lysis buffer, and finally, the immunoprecipitants were resuspended in 1X SDS loading buffer and boiled at 95 °C for 10 min. The beads were detached, and the supernatant was collected for western blotting.

Assessment of liver pathology

After the mice were anesthetized, liver tissues were harvested and stored at -80 °C or fixed in a 4% paraformaldehyde solution for subsequent staining. Following fixation in paraformaldehyde, liver tissues were further embedded in paraffin and sliced into 5-μm-thick slices. After typical dewaxing by standard techniques, hematoxylin-eosin (HE) was used to stain the paraffin sections to assess histology and vacuolar and fatty changes in the liver. Masson and Sirius red staining was used to assess fibrosis in the liver.

Immunostaining

For immunofluorescence staining, the liver paraffin sections were dewaxed, and antigen retrieval was performed using citrate buffer, followed by antigenic closure at room temperature with 10% goat serum. After 1 h of closure, the liver paraffin sections were incubated with p-Nrf2 antibodies (1:100, Affinity, China, Cat. No. DF7519) overnight at 4 °C. Subsequently, a fluorescent secondary antibody was added and incubated at room temperature for 60 min, followed by 5 min of DAPI staining, and the paraffin sections were observed under a fluorescence microscope (Olympus, Japan, BX53).

For immunohistochemical staining, the liver paraffin sections were dewaxed, and citrate buffer was used for antigen retrieval. Peroxidase activity was inhibited with a 3% hydrogen peroxide solution. Immediately after antigen closure with 10% goat serum at room temperature, the liver paraffin sections were incubated for 1 h, followed by overnight incubation at 4 °C with SIRT1 (1:100, Affinity, China, Cat No. DF7519), F4/80 (1:100, Abcam, USA, Cat. No. ab3004216), IL-1β (1:100, Abcam, USA, Cat. No. ab283818), and IL-6 (1:100, Abcam, USA, Cat. No. ab290735) antibodies. Subsequently, the liver paraffin sections were incubated with secondary antibodies at room temperature for 1 h, followed by DAB staining and hematoxylin staining. Finally, the staining was observed under a microscope.

Transmission electron microscopy (TEM)

As previously described, liver tissue from mice was examined by TEM [27], and the mitochondrial morphology of hepatocytes was observed.

Real-time quantitative PCR analysis

TRIzol reagent was used to obtain RNA from liver and AML12 cells, and a spectrophotometer was used to determine RNA concentrations and purity. Reverse transcription was performed using the Prime Script RT Reagent Kit (Takara, Japan, Cat. No. RR047A) according to the manufacturer’s protocols. RT‒qPCR was performed with the SYBR Green PCR Kit, and changes in gene expression were compared to the control and calculated using Eq. 2− ρρCT. Uniform labeling was performed using β-actin, and the primer sequences were as follows: Tnf-α, sense 5′- ATCTTCTCAAAATTCGAGTGACAAC-3′ and antisense 5′- TGGGAGTAGACAAGGTACAACCC-3′; Il-1β, sense 5′- AGGCCACAGGTATTTTGT-3′ and antisense 5′- GCCCATCCTCTGTGACTC - 3′; Il-6 sense 5′- GCTACCAAACTGGATATAATCAGGA - 3′ and antisense 5′- CCAGGTAGCTATGGTACTCCAGAA - 3′; and β-actin, sense 5′- AGCCATGTACGTAGCCATCCA - 3′ and antisense 5′- TCTCCGGAGTCCATCACAATG - 3′.

Molecular docking analysis

The Yinfo Cloud Computing Platform (https://cloud.yinfotek.com/) was used to perform docking calculations using the Dock6 protocol. In the force field of MMFF94, the 3D structure of puerarin was established using energy minimization. A crystal/NMR structure of the SIRT1 protein (PDB code: 4ZZH, resolution: 3.1 Å) was obtained from the RCSB Protein Data Bank (http://www.rcsb.org/). Using the crystal ligand, the binding pocket was determined. The DOCK 6.9 program was used for semiflexible docking, and the Grid scoring function was used to analyze the output poses [28, 29].

Cell counting Kit-8 (CCK8) experiment

The optimal concentration of puerarin was identified using a CCK8 assay kit (Biosharp, China, Cat. No. BS350B). AML12 cells were inoculated in a 96-well plate and treated with different puerarin concentrations (0, 50, 75, 100, 125, 150, 200 μM) for 24 h. Then, 10 μl of CCK-8 solution was added to each well and incubated at 37 °C for 2 h. Finally, a microplate reader (Thermo Scientific, USA, Varioskan Flash) was used to detect the absorbance at 450 nm.

Determination of iron levels

A tissue iron assay kit (Solarbio, China, BC4355) was used to measure total liver tissue iron concentrations. Liver tissue (0.1 g) was homogenized in an ice bath with 1 ml of extraction solution. The sample was centrifuged at 4000 g and 4 °C for 10 min, and the supernatant was used for subsequent measurements according to the manufacturer’s instructions. Using a microplate reader (Thermo Scientific, USA, Varioskan Flash), the absorbance value was measured at 520 nm.

A ferrous ion assay kit (Solarbio, China, BC5415) was used to measure Fe2+ levels in liver tissue. Liver tissue (0.1 g) was homogenized in an ice bath in 1 ml of Reagent I. The sample was centrifuged at 10,000 × g for 10 min at 4 °C, and the supernatant was used for subsequent measurements according to the manufacturer’s instructions. Using a microplate reader (Thermo Scientific, USA, Varioskan Flash), the absorbance value was measured at 593 nm.

FerroOrange staining

Using a FerroOrange kit (Dojindo, Shanghai, China, Cat. No. F374), intracellular Fe2+ levels were detected. AML12 cells were incubated with 1 μM FerroOrange working solution at 37 °C for 30 min, and then the fluorescence intensity was detected using a fluorescence microscope (Andor, Britain, BC43).

Detection of ROS

The liver paraffin sections were incubated with a 1% dihydroethidium (DHE) solution (Beyotime, China, Cat. No. S0063) for 30 min at 37 °C, and fluorescence was observed by fluorescence microscopy (Olympus, Japan, BX53) at an excitation wavelength of 580 nm.

Statistical analysis

The data are reported as the mean ± SD, and the experiments were repeated at least three time. The data were analyzed using GraphPad 8.0 software, one-way analysis of variance and t tests, and P < 0.05 was considered to indicate a significant difference.